Product name :AccuPower DNA Sequencing Kit 0.5 ml tubes

Catalog Number :K-1010

Quantity :25 reactions

Price :203 Eur

Pay now with :

Supplier :Bioneer


AccuPower® DNA Sequencing Kit is a premix-type product, which contains all reagents for DNA sequencing lyophilized in one tube so the DNA sequence can be analyzed rapidly and accurately. Because sequencing reaction is run at high temperatures during thermal cycling, alkaline denaturation of double-stranded DNA is not necessary and problems from the template DNA secondary structure and high GC content can be minimized. The product also contains 7-deaza dGTP, minimizing band compression. The best sequencing results can be obtained since band intensity background is minimized by using sequencing grade Top™ DNA polymerase, of which 5’->3’ exonuclease activity is deactivated by cloning DNA polymerase gene of Thermus thermophilus into E.coli and manipulating the gene.


Sensitivity & reproducibility

All components necessary for a successful reaction have been dispensed in single-reaction portions for convenience, and the patented AccuPower® technology provides unrivaled reagent stability and result reproducibility.


All components are premixed and lyophilized in each G/A/T/C tube
G mix : ddGTPs/dNTPs
A mix : ddATPs/dNTPs
T mix : ddTTPs/dNTPs
C mix : ddCTPs/dNTPs
Each mix contains buffer and Top™ DNA polymerase.

* A specific dye which doesn’t affect the sequencing reaction is included to enable checking of the mixing process and monitoring the loss of reaction solution.

* Reducing repetitive and tedious pipetting and mixing minimizes experimental errors.
Storage : Store at -20°C


figure1

Fig. 1. The sequence analysis of plasmid DNA

DNA sequence analysis of purified plasmid DNA 1 μg of the purified sample was sequenced using AccuPower® DNA Sequencing Kit(K-1010) and stained by Silverstar® Staining Kit (K-1050)



References1. Template DNA & primer

   PCR product(200 bp) 100~300 ng
   Primer(17-24mer) 20~30 pmoles
   Plasmid DNA(3,000 bp) 1~2 μg
   Primer(17-24mer) 20~30 pmoles



References2. Primer Sequences

 M13/pUC(-47) Forward Primer 24mer
 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'
 M13/pUC(-48) Reverse Primer 24mer
 5'-d(AGCGGATAACAATTTCACAGGA)-3'

figure1

Ask Technical File!

Question about this product?

Name

Email Address

Message

Retype code:

random val Reload Image


[Related Products]AccuPower DNA Sequencing Kit 0.5 ml tubes

Filter: (Type enter to validate)
  Cat_Number Product name Supplier Quantity Price Tech More
K-1010 AccuPower DNA Sequencing Kit 0.5 ml tubes Bioneer 25 reactions 203 K-1010 AccuPower DNA Sequencing Kit 0.5 ml tubes Bioneer 25 reactions 203€
ASK
Pub
K-1010-1 AccuPower DNA Sequencing Kit 0.2 ml thin wall 8 strip tubes Bioneer 24 reactions 203 K-1010-1 AccuPower DNA Sequencing Kit 0.2 ml thin wall 8 strip tubes Bioneer 24 reactions 203€
ASK
Pub
K-1020-1 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 500 reactions 1074 K-1020-1 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 500 reactions 1074€
ASK
Pub
K-1020 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 100 reactions 307 K-1020 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 100 reactions 307€
ASK
Pub
K-2013 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 150 K-2013 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 150€ Pub
K-2017 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 498 K-2017 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 498€ Pub
K-2042 AccuPower RT PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 259 K-2042 AccuPower RT PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 259€ Pub
K-2043 AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 721 K-2043 AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 721€ Pub
K-2043-B AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 1340 K-2043-B AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 1340€ Pub
K-2112 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 456 K-2112 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 456€ Pub
K-2114 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 913 K-2114 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 913€ Pub
K-5052 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 215 K-5052 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 215€ Pub
K-5053 AccuPower HotStart PCR PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 214 K-5053 AccuPower HotStart PCR PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 214€ Pub
K-5057 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 741 K-5057 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 741€ Pub
3765.X 2.0 ml MCT Tube 500 tubes pk 10 pks case Biotix 144 3765.X 2.0 ml MCT Tube 500 tubes pk 10 pks case Biotix 144€
ASK
Pub
4445.X 1.6 ml MCT Tube 1.6ml MCT SC GRAD NAT Biotix 500 tubes/pk 10 pks/case 185 4445.X 1.6 ml MCT Tube 1.6ml MCT SC GRAD NAT Biotix 500 tubes/pk 10 pks/case 185€
ASK
Pub
AKHB48 Human Apo B 48 ELISA KIT 2.5 160 ng ml Shibayagi 96 wells/kit - 50µl/well 729.75 AKHB48 Human Apo B 48 ELISA KIT 2.5 160 ng ml Shibayagi 96 wells/kit - 50µl/well 729.75€ Pub
BB50-DX-CE Bullet Blender 50-DX homogenizer, CE certified, for up to 8 samples in 50 mL tubes, with air cooling and noise insulation. Next Advence 3831 BB50-DX-CE Bullet Blender 50-DX homogenizer, CE certified, for up to 8 samples in 50 mL tubes, with air cooling and noise insulation. Next Advence 3831€
ASK
Pub
BB50AU-CE Homogenizer for 8 samples in 50mL tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Upgraded elect Next Advence 4985 BB50AU-CE Homogenizer for 8 samples in 50mL tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Upgraded elect Next Advence 4985€
ASK
Pub
BIO-37042 DNA kits, Column-free Isolation: SureClean Bioline 1 x 5ml 62 BIO-37042 DNA kits, Column-free Isolation: SureClean Bioline 1 x 5ml 62€
ASK
Pub
D-1030-1 AccuLadder 100 bp DNA Size Marker 100 2,000 bp Bioneer 315 ul x 2 tubes (54 ng/ul) 227 D-1030-1 AccuLadder 100 bp DNA Size Marker 100 2,000 bp Bioneer 315 ul x 2 tubes (54 ng/ul) 227€ Pub
D-1040-1 AccuLadder 1 kb DNA Size Marker 500 10,200 bp Bioneer 500 ul x 2 tubes (65 ng/ul) 262 D-1040-1 AccuLadder 1 kb DNA Size Marker 500 10,200 bp Bioneer 500 ul x 2 tubes (65 ng/ul) 262€ Pub
H1212-35A Rotisserie for 12 of 300 x 35 mm diameter bottles, 24 of 150 x 35 mm diameter bottles or 24 of 50 ml tubes horizonal. Fits H5000 only Labnet International Inc. 343 H1212-35A Rotisserie for 12 of 300 x 35 mm diameter bottles, 24 of 150 x 35 mm diameter bottles or 24 of 50 ml tubes horizonal. Fits H5000 only Labnet International Inc. 343€
ASK
Pub
K-2012 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 76 K-2012 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 76€ Pub
K-2012-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 176 K-2012-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 176€ Pub
K-2016 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 300 K-2016 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 300€ Pub
K-2016-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 488 K-2016-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 488€ Pub
K-2111 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 114 K-2111 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 114€ Pub
K-2113 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 228 K-2113 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 228€ Pub
K-2611 AccuPower PyroHotStart Taq PCR PreMix NEW 0.2 ml thin-wall 8-strip tubes with attached cap 96 tubes Bioneer 20 ul 174 K-2611 AccuPower PyroHotStart Taq PCR PreMix NEW 0.2 ml thin-wall 8-strip tubes with attached cap 96 tubes Bioneer 20 ul 174€
ASK
Pub
K-5050 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 90 K-5050 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 90€ Pub
K-5050-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 144 K-5050-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 144€ Pub
K-5051 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 370 K-5051 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 370€ Pub
K-5051-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 481 K-5051-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 481€ Pub
K-6251 AccuPower GreenStar qPCR Master Mix NEW 2.5 ml 100 reactions Bioneer 50 ul 200 K-6251 AccuPower GreenStar qPCR Master Mix NEW 2.5 ml 100 reactions Bioneer 50 ul 200€ Pub
K-6252 AccuPower GreenStar qPCR Master Mix NEW 5.0 ml 200 reactions Bioneer 50 ul 323 K-6252 AccuPower GreenStar qPCR Master Mix NEW 5.0 ml 200 reactions Bioneer 50 ul 323€ Pub
K280-50 Mitochondrial DNA Isolation Kit50 assays Biovision 50 assays 390.285 K280-50 Mitochondrial DNA Isolation Kit50 assays Biovision 50 assays 390.285€ Pub
K403-50 ApoBrdU IHC DNA Fragmentation Assay Kit50 assays Biovision 50 assays 579 K403-50 ApoBrdU IHC DNA Fragmentation Assay Kit50 assays Biovision 50 assays 579€
ASK
Pub
PP-207L Plant DNA Preparation Kit, L pack Jena Bioscience 500preparations 226 PP-207L Plant DNA Preparation Kit, L pack Jena Bioscience 500preparations 226€
ASK
Pub
PPO-200 ProPrep™ Omni 200 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group Up to 200 ml cultures 460 PPO-200 ProPrep™ Omni 200 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group Up to 200 ml cultures 460€ Pub
RK-040-02 Luteinizing Hormone Releasing Hormone (LH RH)(Human, Rat, Mouse, Porcine) Iodine 125 labeled RIA Kit 1.5uCi Phoenix Peptide 125 RIA tubes 750 RK-040-02 Luteinizing Hormone Releasing Hormone (LH RH)(Human, Rat, Mouse, Porcine) Iodine 125 labeled RIA Kit 1.5uCi Phoenix Peptide 125 RIA tubes 750€ Pub
SL100489-CaS Transfection Reagents and Kits, GenJet™ DNA In Vitro Tranfection Reagent for Ca Ski was pre optimized for most efficiently transfecting Ca Ski cells. Signagen 1 ml 231.368 SL100489-CaS Transfection Reagents and Kits, GenJet™ DNA In Vitro Tranfection Reagent for Ca Ski was pre optimized for most efficiently transfecting Ca Ski cells. Signagen 1 ml 231.368€ Pub
A00091 CD10, CALLA (Neutral Endopeptidase); Clone 56C6 Scy tek 6 ml Ready-to-use 279 A00091 CD10, CALLA (Neutral Endopeptidase); Clone 56C6 Scy tek 6 ml Ready-to-use 279€
ASK
Pub
A00091.0025 CD10, CALLA (Neutral Endopeptidase); Clone 56C6 Scy tek 25 ml Ready-to-use 784 A00091.0025 CD10, CALLA (Neutral Endopeptidase); Clone 56C6 Scy tek 25 ml Ready-to-use 784€
ASK
Pub
A20091 CD10, CALLA (Neutral Endopeptidase); Clone 56C6 Scy tek 2 ml Ready-to-use 165 A20091 CD10, CALLA (Neutral Endopeptidase); Clone 56C6 Scy tek 2 ml Ready-to-use 165€
ASK
Pub
BAH67-0050 Protease, DNASE free heat shock BSA powder, 50gm Equitech 232 BAH67-0050 Protease, DNASE free heat shock BSA powder, 50gm Equitech 232€
ASK
Pub
BAH67-0500 Protease, DNASE free heat shock BSA powder, 500gm Equitech 440 BAH67-0500 Protease, DNASE free heat shock BSA powder, 500gm Equitech 440€
ASK
Pub
02001-500 AccuRuller 100bp DNA Ladders 50μg 500μl (>150 loadings) Maestro 115.6 02001-500 AccuRuller 100bp DNA Ladders 50μg 500μl (>150 loadings) Maestro 115.6€ Pub
02002-500 AccuRuller 100bp Plus DNA Ladders 50μg 500μl (>150 loadings) Maestro 115.6 02002-500 AccuRuller 100bp Plus DNA Ladders 50μg 500μl (>150 loadings) Maestro 115.6€
ASK
Pub
02003-500 AccuRuller 1Kb DNA Ladders 50μg 500μl (>150 loadings) Maestro 115.6 02003-500 AccuRuller 1Kb DNA Ladders 50μg 500μl (>150 loadings) Maestro 115.6€
ASK
Pub
0801017 CELLKINES Natural Human Interleukin 2 (IL 2) TCGF, 500 BRMP Units ml, 50ml Zeptometrix 1 0 0801017 CELLKINES Natural Human Interleukin 2 (IL 2) TCGF, 500 BRMP Units ml, 50ml Zeptometrix 1 0€
ASK
Pub
11004 ReadiUse™ hydrogen peroxide solution *50 mM calibrated and stabilized solution* AAT Bioquest 5x10 mL 124 11004 ReadiUse™ hydrogen peroxide solution *50 mM calibrated and stabilized solution* AAT Bioquest 5x10 mL 124€
ASK
Pub
1929-25 MLS-573151 Biovision 25 mg 416 1929-25 MLS-573151 Biovision 25 mg 416€ Pub
1929-25 MLS-573151; Appearance Yellow solid Biovision 25 mg 437.535 1929-25 MLS-573151; Appearance Yellow solid Biovision 25 mg 437.535€ Pub
1929-5 MLS-573151 Biovision 5 mg 143 1929-5 MLS-573151 Biovision 5 mg 143€ Pub
1929-5 MLS-573151; Appearance Yellow solid Biovision 5 mg 145.53 1929-5 MLS-573151; Appearance Yellow solid Biovision 5 mg 145.53€ Pub
21-113W Screw Cap Tubes & O-Ring Caps Tubes 2.0ml Vials, Sterile White Caps Genesee 500 Vials/Unit 119 21-113W Screw Cap Tubes & O-Ring Caps Tubes 2.0ml Vials, Sterile White Caps Genesee 500 Vials/Unit 119€
ASK
Pub
21-223 5ml Test Tubes, 12x75mm Genesee 129 21-223 5ml Test Tubes, 12x75mm Genesee 129€
ASK
Pub
21-395 Screw Cap Tubes & O-Ring Caps Tubes 50ml Transport Tubes Polypropylene, Sterile Genesee 20 Bags of 25 Tubes/Unit 190 21-395 Screw Cap Tubes & O-Ring Caps Tubes 50ml Transport Tubes Polypropylene, Sterile Genesee 20 Bags of 25 Tubes/Unit 190€
ASK
Pub
228-10330-2 Recombinant E. coli HSP70 DnaK Proteins Ray Biotech 50 205 228-10330-2 Recombinant E. coli HSP70 DnaK Proteins Ray Biotech 50 205€ Pub
228-10331-2 Recombinant E. coli HSP70 DnaK ATPase BD Proteins Ray Biotech 50 205 228-10331-2 Recombinant E. coli HSP70 DnaK ATPase BD Proteins Ray Biotech 50 205€
ASK
Pub
228-10332-2 Recombinant Human HSP70 DnaK Proteins Ray Biotech 50 205 228-10332-2 Recombinant Human HSP70 DnaK Proteins Ray Biotech 50 205€
ASK
Pub
228-10337-1 Recombinant Human DNase Proteins Ray Biotech 500IU 147 228-10337-1 Recombinant Human DNase Proteins Ray Biotech 500IU 147€
ASK
Pub
232961 Tubes 30 ml PPCO AOR without screw cap Herolab 10 104.412 232961 Tubes 30 ml PPCO AOR without screw cap Herolab 10 104.412€
ASK
Pub
252700 Tubes 16 ml PC RB FL Herolab 10 90 252700 Tubes 16 ml PC RB FL Herolab 10 90€
ASK
Pub
3102.X Cryo tubes & Vials 2.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 393 3102.X Cryo tubes & Vials 2.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 393€
ASK
Pub
3103.X Cryo tubes & Vials 3.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 398 3103.X Cryo tubes & Vials 3.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 398€
ASK
Pub
3104.X Cryo tubes & Vials 4.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 452 3104.X Cryo tubes & Vials 4.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 452€
ASK
Pub
33-212X Tube Storage Boxes with Lids Storage Box, Telescope Lid Holds (50) 1.5 2.0ml Tubes Genesee 1 Box/Unit x20 201 33-212X Tube Storage Boxes with Lids Storage Box, Telescope Lid Holds (50) 1.5 2.0ml Tubes Genesee 1 Box/Unit x20 201€
ASK
Pub
3423.X 0.2 ml PCR Tube Flat cap, 1000 tubes pack 10 packs case Biotix 333 3423.X 0.2 ml PCR Tube Flat cap, 1000 tubes pack 10 packs case Biotix 333€
ASK
Pub
3425.X 0.2 ml PCR Tube Dome cap 10 bags of 100 tubes pack 10 packs per case Biotix 333 3425.X 0.2 ml PCR Tube Dome cap 10 bags of 100 tubes pack 10 packs per case Biotix 333€
ASK
Pub
3426.12.X 0.2 ml Strip tubes & caps 80 strips pk 10 pks cs Biotix 769 3426.12.X 0.2 ml Strip tubes & caps 80 strips pk 10 pks cs Biotix 769€
ASK
Pub
3426.8.X 0.2 ml Strip tubes & caps 125 strips pack 10 pks case Biotix 505 3426.8.X 0.2 ml Strip tubes & caps 125 strips pack 10 pks case Biotix 505€
ASK
Pub
3428.8.X 0.2 ml Strip tubes & caps 8 ,120 strips pk 10 pks cs Biotix 895 3428.8.X 0.2 ml Strip tubes & caps 8 ,120 strips pk 10 pks cs Biotix 895€
ASK
Pub
3737.X 0.6 ml PCR tubes 1000 per bag, 10 bags per case Biotix 291 3737.X 0.6 ml PCR tubes 1000 per bag, 10 bags per case Biotix 291€
ASK
Pub
A-2060-A1 AccuPower Calibration Kit for ExicyclerTM 96 Bioneer 1 1696 A-2060-A1 AccuPower Calibration Kit for ExicyclerTM 96 Bioneer 1 1696€ Pub
A07840 Acetyl chloride 98% pfalslandbauer 5000 ML 592 A07840 Acetyl chloride 98% pfalslandbauer 5000 ML 592€
ASK
Pub
BAH67-0050 Protease, DNASE free heat shock BSA powder, 50gm Equitech 50gm 310.8 BAH67-0050 Protease, DNASE free heat shock BSA powder, 50gm Equitech 50gm 310.8€
ASK
Pub
BAH67-0500 Protease, DNASE free heat shock BSA powder, 500gm Equitech 500gm 557.55 BAH67-0500 Protease, DNASE free heat shock BSA powder, 500gm Equitech 500gm 557.55€
ASK
Pub
BB24-AU-CE Homogenizer for 24 samples in microcentrifuge tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Up Next Advence 4850 BB24-AU-CE Homogenizer for 24 samples in microcentrifuge tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Up Next Advence 4850€ Pub
BBX24-CE Homogenizer for 24 samples in microcentrifuge tubes. Includes starter kit of beads, scoops and tubes. Upgraded electronics and CE certification. Next Advence 2684 BBX24-CE Homogenizer for 24 samples in microcentrifuge tubes. Includes starter kit of beads, scoops and tubes. Upgraded electronics and CE certification. Next Advence 2684€ Pub
BBY24M-CE Homogenizer for 24 samples in microcentrifuge tubes. More powerful motor for tough samples. Includes starter kit of beads, scoops and tubes. Air Cooling to prevent heat loading during homogenizatio Next Advence 3594 BBY24M-CE Homogenizer for 24 samples in microcentrifuge tubes. More powerful motor for tough samples. Includes starter kit of beads, scoops and tubes. Air Cooling to prevent heat loading during homogenizatio Next Advence 3594€ Pub
BCSU-0500 Non sterile calf serum, 500ml Equitech 500 ml 129.328 BCSU-0500 Non sterile calf serum, 500ml Equitech 500 ml 129.328€
ASK
Pub
BIO-21048 IMMOLASE DNA Polymerase Bioline 5000 Units 1512 BIO-21048 IMMOLASE DNA Polymerase Bioline 5000 Units 1512€ Pub
BIO-21078 MangoTaq DNA Polymerase Bioline 5000 Units 693.63 BIO-21078 MangoTaq DNA Polymerase Bioline 5000 Units 693.63€
ASK
Pub
BIO-21107 MyTaq DNA Polymerase Bioline 5000 Units 720.09 BIO-21107 MyTaq DNA Polymerase Bioline 5000 Units 720.09€ Pub
BIO-21110 MyTaq Red DNA Polymerase Bioline 5000 Units 720.09 BIO-21110 MyTaq Red DNA Polymerase Bioline 5000 Units 720.09€ Pub
BIO-35026 Rat Genomic DNA Bioline 500µl @ 200ng/µl 101.446 BIO-35026 Rat Genomic DNA Bioline 500µl @ 200ng/µl 101.446€
ASK
Pub
BPUC-0500 Non sterile bovine plasma with sodium citrate, 500ml Equitech 500 ml 132.888 BPUC-0500 Non sterile bovine plasma with sodium citrate, 500ml Equitech 500 ml 132.888€
ASK
Pub
BQ062A-EACL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Calibrator (2 mL vial) Bioquant 148 BQ062A-EACL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Calibrator (2 mL vial) Bioquant 148€
ASK
Pub
BQ062A-EACN ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Control Set (2 x 2 mL vial) Bioquant 180 BQ062A-EACN ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Control Set (2 x 2 mL vial) Bioquant 180€ Pub
BQ062A-EAKP ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: N-Acetyl-p-D-Glucosaminidase (NAG) Kit Bioquant 540 tests 448 BQ062A-EAKP ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: N-Acetyl-p-D-Glucosaminidase (NAG) Kit Bioquant 540 tests 448€ Pub
bs-0836R-A555 Rabbit Anti-MLH1 hMLH 1 Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323 bs-0836R-A555 Rabbit Anti-MLH1 hMLH 1 Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323€ Pub
bs-1276R-A555 Rabbit Anti-ERdj5 DNAJC10 Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323 bs-1276R-A555 Rabbit Anti-ERdj5 DNAJC10 Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323€ Pub
bs-2992R-AF350 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 350 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-2992R-AF350 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 350 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€
ASK
Pub
bs-2992R-AF488 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 488 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-2992R-AF488 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 488 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€
ASK
Pub
bs-6781R-A555 Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323 bs-6781R-A555 Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323€ Pub
bs-6781R-PE Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-6781R-PE Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-6781R-PE-Cy3 Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE-Cy3 Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-6781R-PE-Cy3 Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE-Cy3 Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
bs-7653R-A555 Rabbit Anti-DNase gamma Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323 bs-7653R-A555 Rabbit Anti-DNase gamma Polyclonal Antibody, Alexa Fluor 555 conjugated,Isotype: IgG Sepax 100ug Lyophilized 323€ Pub
bs-7653R-HRP Rabbit Anti-DNase gamma Polyclonal Antibody, HRP Conjugated, 36kDa, Isotype IgG, Application WB(1 100-500), ELISA(1 500-1000) Bioss 100ug Lyophilized 530 bs-7653R-HRP Rabbit Anti-DNase gamma Polyclonal Antibody, HRP Conjugated, 36kDa, Isotype IgG, Application WB(1 100-500), ELISA(1 500-1000) Bioss 100ug Lyophilized 530€ Pub
bs-7653R-PE Rabbit Anti-DNase gamma Polyclonal Antibody, PE Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-7653R-PE Rabbit Anti-DNase gamma Polyclonal Antibody, PE Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-7653R-PE-Cy3 Rabbit Anti-DNase gamma Polyclonal Antibody, PE-Cy3 Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-7653R-PE-Cy3 Rabbit Anti-DNase gamma Polyclonal Antibody, PE-Cy3 Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
BSU-0500 Non sterile bovine serum, 500ml Equitech 500 ml 129.328 BSU-0500 Non sterile bovine serum, 500ml Equitech 500 ml 129.328€
ASK
Pub
CAPC-0500 Non sterile canine plasma with sodium citrate, 500ml Equitech 500 ml 538.671 CAPC-0500 Non sterile canine plasma with sodium citrate, 500ml Equitech 500 ml 538.671€
ASK
Pub
CAPE-0500 Non sterile canine plasma with EDTA, 500ml Equitech 500 ml 538.671 CAPE-0500 Non sterile canine plasma with EDTA, 500ml Equitech 500 ml 538.671€
ASK
Pub
CAPH-0500 Non sterile canine plasma with heparin, 500ml Equitech 500 ml 538.671 CAPH-0500 Non sterile canine plasma with heparin, 500ml Equitech 500 ml 538.671€
ASK
Pub
CAS-0500 Non sterile canine serum, 500ml Equitech 500 ml 488.838 CAS-0500 Non sterile canine serum, 500ml Equitech 500 ml 488.838€
ASK
Pub
CMPC-0050 Non sterile Cynomolgus monkey plasma with sodium citrate,50ml Equitech 50 ml 982.422 CMPC-0050 Non sterile Cynomolgus monkey plasma with sodium citrate,50ml Equitech 50 ml 982.422€
ASK
Pub
CMPC-0500 Non sterile Cynomolgus monkey plasma with sodium citrate, 500ml Equitech 500 ml 6758.3 CMPC-0500 Non sterile Cynomolgus monkey plasma with sodium citrate, 500ml Equitech 500 ml 6758.3€
ASK
Pub
CMPE-0050 Non sterile Cynomolgus monkey plasma with EDTA, 50ml Equitech 50 ml 982.422 CMPE-0050 Non sterile Cynomolgus monkey plasma with EDTA, 50ml Equitech 50 ml 982.422€
ASK
Pub
CMPE-0500 Non sterile Cynomolgus monkey plasma with EDTA, 500ml Equitech 500 ml 6758.3 CMPE-0500 Non sterile Cynomolgus monkey plasma with EDTA, 500ml Equitech 500 ml 6758.3€
ASK
Pub
CMPH-0050 Non sterile Cynomolgus monkey plasma with heparin, 50ml Equitech 50 ml 982.422 CMPH-0050 Non sterile Cynomolgus monkey plasma with heparin, 50ml Equitech 50 ml 982.422€
ASK
Pub
CMPH-0500 Non sterile Cynomolgus monkey plasma with heparin, 500ml Equitech 500 ml 6758.3 CMPH-0500 Non sterile Cynomolgus monkey plasma with heparin, 500ml Equitech 500 ml 6758.3€
ASK
Pub
CMS-0050 Non sterile Cynomolgus monkey serum, 50ml Equitech 50 ml 883.943 CMS-0050 Non sterile Cynomolgus monkey serum, 50ml Equitech 50 ml 883.943€
ASK
Pub
CMS-0500 Non sterile Cynomolgus monkey serum, 500ml Equitech 500 ml 6017.93 CMS-0500 Non sterile Cynomolgus monkey serum, 500ml Equitech 500 ml 6017.93€
ASK
Pub
CQBL-05K CellQuanti Blue™ Cell Viability Assay Kits Bioassays 5000 170.887 CQBL-05K CellQuanti Blue™ Cell Viability Assay Kits Bioassays 5000 170.887€ Pub
CQLD-100 QuantiChrom™ LDH Cytotoxicity Assay Kit, Quantitative determination of cytotoxicity based on cellular lactate dehydrogenase release into cell culture medium by colorimetric (565nm) method. Procedure Bioassays 100tests 113 CQLD-100 QuantiChrom™ LDH Cytotoxicity Assay Kit, Quantitative determination of cytotoxicity based on cellular lactate dehydrogenase release into cell culture medium by colorimetric (565nm) method. Procedure Bioassays 100tests 113€ Pub
CQMT-500 CellQuanti-MTT™ Cell Viability Assay Kits Bioassays 500 tests 133 CQMT-500 CellQuanti-MTT™ Cell Viability Assay Kits Bioassays 500 tests 133€ Pub
CQMT-500 CellQuanti MTT™ Cell Viability Assay Kits Bioassays 500 174.794 CQMT-500 CellQuanti MTT™ Cell Viability Assay Kits Bioassays 500 174.794€ Pub
CS-0500 Non sterile chicken serum, 500ml Equitech 500 ml 155.432 CS-0500 Non sterile chicken serum, 500ml Equitech 500 ml 155.432€
ASK
Pub
D2NO-100 QuantiChrom™ Nitric Oxide Assay Kit, Quantitative determination of nitric oxide by colorimetric (540nm) method Bioassays 100Tests 265 D2NO-100 QuantiChrom™ Nitric Oxide Assay Kit, Quantitative determination of nitric oxide by colorimetric (540nm) method Bioassays 100Tests 265€ Pub
DAMY-100 QuantiChrom™ α-Amylase Assay Kit, Quantitative determination of α-amylase activity by colorimetric (595nm) method Bioassays 100Tests 405 DAMY-100 QuantiChrom™ α-Amylase Assay Kit, Quantitative determination of α-amylase activity by colorimetric (595nm) method Bioassays 100Tests 405€ Pub
DICA-500 QuantiChrom™ Calcium Assay Kit, Quantitative determination of calcium ion Ca2+ by colorimetric (612nm) method Bioassays 500Tests 320 DICA-500 QuantiChrom™ Calcium Assay Kit, Quantitative determination of calcium ion Ca2+ by colorimetric (612nm) method Bioassays 500Tests 320€ Pub
DIUR-500 QuantiChrom™ Urea Assay Kit, Quantitative determination of urea by chemical colorimetric (520nm) method Bioassays 500Tests 300 DIUR-500 QuantiChrom™ Urea Assay Kit, Quantitative determination of urea by chemical colorimetric (520nm) method Bioassays 500Tests 300€ Pub
DS-0500 Non sterile donkey serum, 500ml Equitech 500 ml 148.312 DS-0500 Non sterile donkey serum, 500ml Equitech 500 ml 148.312€
ASK
Pub
DS-PB-00617 Rabbit Anti-Bovine DNAse 1 Antibodies Ray Biotech 1 ml 485 DS-PB-00617 Rabbit Anti-Bovine DNAse 1 Antibodies Ray Biotech 1 ml 485€
ASK
Pub
DS-PB-01349 Rabbit Anti-Human mlH1 Antibodies Ray Biotech 50 411 DS-PB-01349 Rabbit Anti-Human mlH1 Antibodies Ray Biotech 50 411€
ASK
Pub
E-1792 Mlu I Bioneer 5000 unit 390 E-1792 Mlu I Bioneer 5000 unit 390€ Pub
E-3061 Includes 10 X reaction buffer, 100mM MgCl2, 50mM DTT, 10mM ATP, 25 ug mL BSA Bioneer 20000 Units 90 E-3061 Includes 10 X reaction buffer, 100mM MgCl2, 50mM DTT, 10mM ATP, 25 ug mL BSA Bioneer 20000 Units 90€ Pub
E-3062 Includes 10 X reaction buffer, 100mM MgCl2, 50mM DTT, 10mM ATP, 25 ug mL BSA Bioneer 100000 Units 210 E-3062 Includes 10 X reaction buffer, 100mM MgCl2, 50mM DTT, 10mM ATP, 25 ug mL BSA Bioneer 100000 Units 210€ Pub
E-3122 5 tubes of 10,000 Units Includes 5 X reaction buffer, 100 mM DTT Bioneer 50000 Units 323 E-3122 5 tubes of 10,000 Units Includes 5 X reaction buffer, 100 mM DTT Bioneer 50000 Units 323€ Pub
E2HL-100 EnzyChrom™ AF HDL and LDL VLDL Assay Kit, Quantitative determination of HDL and LDL VLDL cholesterol by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 60 min. Kit size 100 tes Bioassays 100tests 393 E2HL-100 EnzyChrom™ AF HDL and LDL VLDL Assay Kit, Quantitative determination of HDL and LDL VLDL cholesterol by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 60 min. Kit size 100 tes Bioassays 100tests 393€ Pub
E2ND-100 EnzyChrom™ NAD NADH Assay Kit, Sensitive determination of NAD and NADH by colorimetric (565nm) method. Procedure 15 min. Kit size 100 tests. Detection limit 0.05 µM. Shelf life 6 months. Shipping Bioassays 100tests 364 E2ND-100 EnzyChrom™ NAD NADH Assay Kit, Sensitive determination of NAD and NADH by colorimetric (565nm) method. Procedure 15 min. Kit size 100 tests. Detection limit 0.05 µM. Shelf life 6 months. Shipping Bioassays 100tests 364€ Pub
EACL-100 EnzyChrom™ Acetylcholine Assay Kit, Quantitative determination of acetylcholine by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 30 min. Kit size 100 tests. Detection limit Bioassays 100tests 345 EACL-100 EnzyChrom™ Acetylcholine Assay Kit, Quantitative determination of acetylcholine by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 30 min. Kit size 100 tests. Detection limit Bioassays 100tests 345€ Pub
EASC-100 EnzyChrom™ Ascorbic Acid Assay Kit, Quantitative determination of ascorbic acid by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 10 min. Kit size 100 tests. Detection limit Bioassays 100tests 335 EASC-100 EnzyChrom™ Ascorbic Acid Assay Kit, Quantitative determination of ascorbic acid by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 10 min. Kit size 100 tests. Detection limit Bioassays 100tests 335€ Pub
ECAT-100 EnzyChrom™ Catalase Assay Kit, Quantitative determination of catalase activity by colorimetric (570nm) or fluorometric (530nm 590nm) methods. Procedure 40 min. Kit size 100 tests. Detection limit 0 Bioassays 100tests 258 ECAT-100 EnzyChrom™ Catalase Assay Kit, Quantitative determination of catalase activity by colorimetric (570nm) or fluorometric (530nm 590nm) methods. Procedure 40 min. Kit size 100 tests. Detection limit 0 Bioassays 100tests 258€ Pub
EDLC-100 EnzyChrom™ D-Lactate Assay Kit, Quantitative determination of D-lactic acid by colorimetric (565nm) method Bioassays 100Tests 362 EDLC-100 EnzyChrom™ D-Lactate Assay Kit, Quantitative determination of D-lactic acid by colorimetric (565nm) method Bioassays 100Tests 362€ Pub
EDLC-100 EnzyChrom™ D-Lactate Assay Kit, Quantitative determination of D-lactic acid by colorimetric (565nm) method. Procedure 20 min. Kit size 100 tests. Detection limit 0.05 mM. Shelf life 6 months. Ship Bioassays 100tests 345 EDLC-100 EnzyChrom™ D-Lactate Assay Kit, Quantitative determination of D-lactic acid by colorimetric (565nm) method. Procedure 20 min. Kit size 100 tests. Detection limit 0.05 mM. Shelf life 6 months. Ship Bioassays 100tests 345€ Pub
EFFA-100 EnzyChrom™ Free Fatty Acid Assay Kit, Quantitative determination of free fatty acid by colorimetric (570nm) or fluorimetric (530 590nm) method. Procedure 30 min. Kit size 100 tests. Detection limit Bioassays 100tests 355 EFFA-100 EnzyChrom™ Free Fatty Acid Assay Kit, Quantitative determination of free fatty acid by colorimetric (570nm) or fluorimetric (530 590nm) method. Procedure 30 min. Kit size 100 tests. Detection limit Bioassays 100tests 355€ Pub
EFRU-100 EnzyChrom™ Fructose Assay Kit, Quantitative determination of fructose by colorimetric (565nm) method. Procedure 70 min. Kit size 100 tests. Detection limit 12 µM fructose. Shelf life 3 months. Shi Bioassays 100tests 335 EFRU-100 EnzyChrom™ Fructose Assay Kit, Quantitative determination of fructose by colorimetric (565nm) method. Procedure 70 min. Kit size 100 tests. Detection limit 12 µM fructose. Shelf life 3 months. Shi Bioassays 100tests 335€ Pub
EKIN-400 EnzyChrom™ Kinase Assay Kit, Rapid mix-and-measure procedure for determination of kinase activity and high-throµghput screening for kinase inhibitors by fluorimetric (530nm 590nm) method Bioassays 400Tests 250 EKIN-400 EnzyChrom™ Kinase Assay Kit, Rapid mix-and-measure procedure for determination of kinase activity and high-throµghput screening for kinase inhibitors by fluorimetric (530nm 590nm) method Bioassays 400Tests 250€ Pub
ELAC-100 EnzyChrom™ Lactose Assay Kit, Quantitative determination of lactose by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 30 min. Kit size 100 tests. Detection limit 6 µM. Shelf Bioassays 100tests 335 ELAC-100 EnzyChrom™ Lactose Assay Kit, Quantitative determination of lactose by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 30 min. Kit size 100 tests. Detection limit 6 µM. Shelf Bioassays 100tests 335€ Pub
EPPD-100 EnzyChrom™ Phospholipase D Assay Kit, Quantitative determination of phospholipase D activity by colorimetric (570nm) or fluorimetric (530 590nm) method. Procedure 30 min. Kit size 100 tests. Detecti Bioassays 100tests 287 EPPD-100 EnzyChrom™ Phospholipase D Assay Kit, Quantitative determination of phospholipase D activity by colorimetric (570nm) or fluorimetric (530 590nm) method. Procedure 30 min. Kit size 100 tests. Detecti Bioassays 100tests 287€ Pub
EPYR-100 EnzyChrom™ Pyruvate Assay Kit, Quantitative determination of pyruvate by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 20 min. Kit size 100 tests. Detection limit fluorimetr Bioassays 100tests 316 EPYR-100 EnzyChrom™ Pyruvate Assay Kit, Quantitative determination of pyruvate by colorimetric (570nm) or fluorimetric (530nm 590nm) methods. Procedure 20 min. Kit size 100 tests. Detection limit fluorimetr Bioassays 100tests 316€ Pub
ES-0500 Non sterile equine serum, 500ml Equitech 500 ml 148.312 ES-0500 Non sterile equine serum, 500ml Equitech 500 ml 148.312€
ASK
Pub
EXOTC50A-1 ExoQuick TC 50ml SBI 50 ml 966 EXOTC50A-1 ExoQuick TC 50ml SBI 50 ml 966€ Pub
FAATR001 After-Tri RNA Purification Mini Kit (50prep) Faworgen 5kits 400 FAATR001 After-Tri RNA Purification Mini Kit (50prep) Faworgen 5kits 400€ Pub
FPC-0500 Non sterile feline plasma with sodium citrate, 500ml Equitech 500 ml 982.422 FPC-0500 Non sterile feline plasma with sodium citrate, 500ml Equitech 500 ml 982.422€
ASK
Pub
FPE-0500 Non sterile feline plasma with EDTA, 500ml Equitech 500 ml 982.422 FPE-0500 Non sterile feline plasma with EDTA, 500ml Equitech 500 ml 982.422€
ASK
Pub
FPH-0500 Non sterile feline plasma with heparin, 500ml Equitech 500 ml 982.422 FPH-0500 Non sterile feline plasma with heparin, 500ml Equitech 500 ml 982.422€
ASK
Pub
FS-0500 Non sterile feline serum, 500ml Equitech 500 ml 883.943 FS-0500 Non sterile feline serum, 500ml Equitech 500 ml 883.943€
ASK
Pub
G008 Taq DNA Polymerase 5000U ABM Goods 5000U; 5U/ul 183.75 G008 Taq DNA Polymerase 5000U ABM Goods 5000U; 5U/ul 183.75€ Pub
G017 500bp DNA Marker ABM Goods 100 lanes (6ul/lane) 77.7 G017 500bp DNA Marker ABM Goods 100 lanes (6ul/lane) 77.7€
ASK
Pub
G063 Blasticidin ABM Goods 50mg/ml 189 G063 Blasticidin ABM Goods 50mg/ml 189€
ASK
Pub
G078 Precision Taq DNA Polymerase ABM Goods 500U; 5U/ul 159.6 G078 Precision Taq DNA Polymerase ABM Goods 500U; 5U/ul 159.6€ Pub
G193 100bp Plus DNA Ladder ABM Goods 500ul 94.5 G193 100bp Plus DNA Ladder ABM Goods 500ul 94.5€ Pub
G2100 DNAfectin 2100 (A) ABM Goods 1ml; 100-500 transfections 135 G2100 DNAfectin 2100 (A) ABM Goods 1ml; 100-500 transfections 135€ Pub
G248 1kb Plus DNA Ladder ABM Goods 500ul 94.5 G248 1kb Plus DNA Ladder ABM Goods 500ul 94.5€ Pub
GM345 100 1000bp DNA Marker, Ready to Use BBI Biotech 13 DNA fragments: 50, 100X2, 150, 200X2 ,250, 300, 400, 500X2, 600, 700, 800, 900 and 1031bp 84 GM345 100 1000bp DNA Marker, Ready to Use BBI Biotech 13 DNA fragments: 50, 100X2, 150, 200X2 ,250, 300, 400, 500X2, 600, 700, 800, 900 and 1031bp 84€ Pub
GPC-0500 Non sterile goat plasma with sodium citrate, 500ml Equitech 500 ml 156.618 GPC-0500 Non sterile goat plasma with sodium citrate, 500ml Equitech 500 ml 156.618€
ASK
Pub
GPE-0500 Non sterile goat plasma with EDTA, 500ml Equitech 500 ml 156.618 GPE-0500 Non sterile goat plasma with EDTA, 500ml Equitech 500 ml 156.618€
ASK
Pub
GPH-0500 Non sterile goat plasma with heparin, 500ml Equitech 500 ml 156.618 GPH-0500 Non sterile goat plasma with heparin, 500ml Equitech 500 ml 156.618€
ASK
Pub
GPPE-0050 Non sterile guinea pig plasma with EDTA, 50ml Equitech 50 ml 218.316 GPPE-0050 Non sterile guinea pig plasma with EDTA, 50ml Equitech 50 ml 218.316€
ASK
Pub
GPPE-0500 Non sterile guinea pig plasma with EDTA, 500ml Equitech 500 ml 711.9 GPPE-0500 Non sterile guinea pig plasma with EDTA, 500ml Equitech 500 ml 711.9€
ASK
Pub
GPS-0050 Non sterile guinea pig serum, 50ml Equitech 50 ml 193.2 GPS-0050 Non sterile guinea pig serum, 50ml Equitech 50 ml 193.2€
ASK
Pub
GPS-0500 Non sterile guinea pig serum, 500ml Equitech 500 ml 538.65 GPS-0500 Non sterile guinea pig serum, 500ml Equitech 500 ml 538.65€
ASK
Pub
GS-0500 Non sterile goat serum, 500ml Equitech 500 ml 148.312 GS-0500 Non sterile goat serum, 500ml Equitech 500 ml 148.312€
ASK
Pub
HA241 Colistin (Polymyxin E) ELISA kit Sensitivity 0.5ppb Sample chicken,liver Wanger 1 kit 569.52 HA241 Colistin (Polymyxin E) ELISA kit Sensitivity 0.5ppb Sample chicken,liver Wanger 1 kit 569.52€ Pub
HAPC-0050 Non sterile hamster plasma with sodium citrate, 50ml Equitech 50 ml 249 HAPC-0050 Non sterile hamster plasma with sodium citrate, 50ml Equitech 50 ml 249€
ASK
Pub
HAPE-0050 Non sterile hamster plasma with EDTA, 50ml Equitech 50 ml 249 HAPE-0050 Non sterile hamster plasma with EDTA, 50ml Equitech 50 ml 249€
ASK
Pub
HAPH-0050 Non sterile hamster plasma with heparin, 50ml Equitech 50 ml 249 HAPH-0050 Non sterile hamster plasma with heparin, 50ml Equitech 50 ml 249€
ASK
Pub
HAS-0050 Non sterile hamster serum, 50ml Equitech 50 ml 217.35 HAS-0050 Non sterile hamster serum, 50ml Equitech 50 ml 217.35€
ASK
Pub
HAS-0500 Non sterile hamster serum, 500ml Equitech 500 ml 588 HAS-0500 Non sterile hamster serum, 500ml Equitech 500 ml 588€
ASK
Pub
ICK-N50ml(K2EDTA) Chicken Plasma 50 ml Innovative Research INC 50ml 282 ICK-N50ml(K2EDTA) Chicken Plasma 50 ml Innovative Research INC 50ml 282€
ASK
Pub
ICK-N50ml(K3EDTA) Chicken Plasma 50 ml Innovative Research INC 50ml 282 ICK-N50ml(K3EDTA) Chicken Plasma 50 ml Innovative Research INC 50ml 282€
ASK
Pub
IQ253 Mouse AntiMad1L1 Target Antigen Mad1L1 Host Isotype Mouse IgG2b Application IF; IP; Imunquest 50ul (2mg/ml) 427 IQ253 Mouse AntiMad1L1 Target Antigen Mad1L1 Host Isotype Mouse IgG2b Application IF; IP; Imunquest 50ul (2mg/ml) 427€
ASK
Pub
IQ254 Mouse AntiCENPE Target Antigen CENPE Host Isotype Mouse IgG1 Application ICC; IF; IP; WB (after antigen concentration); Imunquest 50ul (0.45mg/ml) 427 IQ254 Mouse AntiCENPE Target Antigen CENPE Host Isotype Mouse IgG1 Application ICC; IF; IP; WB (after antigen concentration); Imunquest 50ul (0.45mg/ml) 427€
ASK
Pub
IQ255 Mouse (monoclonal) AntiBUB1 Target Antigen BUB1 Host Isotype Mouse IgG1 Application IF; IP; WB; Imunquest 50ul (1.1mg/ml) 427 IQ255 Mouse (monoclonal) AntiBUB1 Target Antigen BUB1 Host Isotype Mouse IgG1 Application IF; IP; WB; Imunquest 50ul (1.1mg/ml) 427€
ASK
Pub
IQ259 Mouse AntiSMN (Gemin1) Target Antigen SMN (Gemin1) Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1.8mg/ml) 427 IQ259 Mouse AntiSMN (Gemin1) Target Antigen SMN (Gemin1) Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1.8mg/ml) 427€
ASK
Pub
IQ260 Mouse AntiGemin2 Target Antigen Gemin2 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ260 Mouse AntiGemin2 Target Antigen Gemin2 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ261 Mouse AntiGemin3 Target Antigen Gemin3 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ261 Mouse AntiGemin3 Target Antigen Gemin3 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ262 Mouse AntihnRNPA1 Target Antigen hnRNPA1 Host Isotype Mouse IgG2a Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ262 Mouse AntihnRNPA1 Target Antigen hnRNPA1 Host Isotype Mouse IgG2a Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ263 Mouse AntihnRNPA1 Target Antigen hnRNPA1 Host Isotype Mouse IgG2b Application E; IB; IF; IP; Imunquest 50ul (2.5mg/ml) 427 IQ263 Mouse AntihnRNPA1 Target Antigen hnRNPA1 Host Isotype Mouse IgG2b Application E; IB; IF; IP; Imunquest 50ul (2.5mg/ml) 427€
ASK
Pub
IQ264 Mouse AntihnRNPF Target Antigen hnRNPF Host Isotype Mouse IgG1 Application E; WB; Imunquest 50ul (1mg/ml) 427 IQ264 Mouse AntihnRNPF Target Antigen hnRNPF Host Isotype Mouse IgG1 Application E; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ265 Mouse AntihnRNPF H Target Antigen hnRNPF H Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ265 Mouse AntihnRNPF H Target Antigen hnRNPF H Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ266 Mouse AntihnRNPU Target Antigen hnRNPU Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ266 Mouse AntihnRNPU Target Antigen hnRNPU Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ267 Mouse AntihnRNPQ Target Antigen hnRNPQ Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ267 Mouse AntihnRNPQ Target Antigen hnRNPQ Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ268 Mouse AntihnRNPL Target Antigen hnRNPL Host Isotype Mouse IgG1 Application E; IB; IF; IP; Imunquest 50ul (1mg/ml) 427 IQ268 Mouse AntihnRNPL Target Antigen hnRNPL Host Isotype Mouse IgG1 Application E; IB; IF; IP; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ269 Mouse AntihnRNPK J Target Antigen hnRNPK J Host Isotype Mouse IgG2b Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ269 Mouse AntihnRNPK J Target Antigen hnRNPK J Host Isotype Mouse IgG2b Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ270 Mouse AntihnRNPC1 C2 Target Antigen hnRNPC1 C2 Host Isotype Mouse IgG1 Application E; IF; IP; WB; IHC (P) Imunquest 50ul (1mg/ml) 427 IQ270 Mouse AntihnRNPC1 C2 Target Antigen hnRNPC1 C2 Host Isotype Mouse IgG1 Application E; IF; IP; WB; IHC (P) Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ271 Mouse AntihnRNPA2 B1 Target Antigen hnRNPA2 B1 Host Isotype Mouse IgG2a Application E; IF; IHC(P); IP; WB; Imunquest 50ul (1mg/ml) 427 IQ271 Mouse AntihnRNPA2 B1 Target Antigen hnRNPA2 B1 Host Isotype Mouse IgG2a Application E; IF; IHC(P); IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ272 Mouse AntiPABP Target Antigen PABP Host Isotype Mouse IgG2b Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ272 Mouse AntiPABP Target Antigen PABP Host Isotype Mouse IgG2b Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ273 Mouse AntiFXR2 Target Antigen FXR2 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ273 Mouse AntiFXR2 Target Antigen FXR2 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ274 Mouse AntiFMR1 (Drosophila) Target Antigen FMR1 (Drosophila) Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 492 IQ274 Mouse AntiFMR1 (Drosophila) Target Antigen FMR1 (Drosophila) Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 492€
ASK
Pub
IQ275 Mouse AntiY14 Target Antigen Y14 Host Isotype Mouse IgG2b Application E; IF; IP; WB; Imunquest 50ul (2.2mg/ml) 427 IQ275 Mouse AntiY14 Target Antigen Y14 Host Isotype Mouse IgG2b Application E; IF; IP; WB; Imunquest 50ul (2.2mg/ml) 427€
ASK
Pub
IQ276 Mouse AntiALY Target Antigen ALY Host Isotype Mouse IgG1 Application E; IF; IP; WB;IHC (P) Imunquest 50ul (1mg/ml) 427 IQ276 Mouse AntiALY Target Antigen ALY Host Isotype Mouse IgG1 Application E; IF; IP; WB;IHC (P) Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ278 Mouse AntiTransportin1 Target Antigen Transportin1 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ278 Mouse AntiTransportin1 Target Antigen Transportin1 Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ279 Mouse AntiTAP Target Antigen TAP Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ279 Mouse AntiTAP Target Antigen TAP Host Isotype Mouse IgG1 Application E; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ304 Rat AntiHIV2 Nef Target Antigen HIV2 Nef Host Isotype Rat IgG1 Application IP; WB; Imunquest 50ul (1mg/ml) 492 IQ304 Rat AntiHIV2 Nef Target Antigen HIV2 Nef Host Isotype Rat IgG1 Application IP; WB; Imunquest 50ul (1mg/ml) 492€
ASK
Pub
IQ305 Rat AntiKaryopherin alpha2 (KPNA2) Target Antigen Karyopherin alpha2 (KPNA2) Host Isotype Rat IgG2a Application WB; Imunquest 50ul (1mg/ml) 492 IQ305 Rat AntiKaryopherin alpha2 (KPNA2) Target Antigen Karyopherin alpha2 (KPNA2) Host Isotype Rat IgG2a Application WB; Imunquest 50ul (1mg/ml) 492€
ASK
Pub
IQ306 Rat AntiORC6 (origin recognition complex 6) Target Antigen ORC6 (origin recognition complex 6) Host Isotype Rat IgG2a Application ChIP; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ306 Rat AntiORC6 (origin recognition complex 6) Target Antigen ORC6 (origin recognition complex 6) Host Isotype Rat IgG2a Application ChIP; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ307 Rat AntiORC2 (origin recognition complex 2) Target Antigen ORC2 (origin recognition complex 2) Host Isotype Rat IgG2a Application IP; WB; Imunquest 50ul (1mg/ml) 427 IQ307 Rat AntiORC2 (origin recognition complex 2) Target Antigen ORC2 (origin recognition complex 2) Host Isotype Rat IgG2a Application IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ308 Rat AntiORC3 (origin recognition complex 3) Target Antigen ORC3 (origin recognition complex 3) Host Isotype Rat IgG2b Application IP; WB; Imunquest 50ul (1mg/ml) 427 IQ308 Rat AntiORC3 (origin recognition complex 3) Target Antigen ORC3 (origin recognition complex 3) Host Isotype Rat IgG2b Application IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ309 Rat AntiORC1 (origin recognition complex 1) Target Antigen ORC1 (origin recognition complex 1) Host Isotype Rat IgG1 Application IP; WB; Imunquest 50ul (1mg/ml) 427 IQ309 Rat AntiORC1 (origin recognition complex 1) Target Antigen ORC1 (origin recognition complex 1) Host Isotype Rat IgG1 Application IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ311 Rat AntiNidogen EnactinG2 Domain Target Antigen Nidogen EnactinG2 Domain Host Isotype Rat IgG2b Application E; WB; Imunquest 50ul (1mg/ml) 427 IQ311 Rat AntiNidogen EnactinG2 Domain Target Antigen Nidogen EnactinG2 Domain Host Isotype Rat IgG2b Application E; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ313 Rat AntiNidogen EnactinG1 Domain Target Antigen Nidogen EnactinG1 Domain Host Isotype Rat IgG2a Application E; WB; Imunquest 50ul (1mg/ml) 427 IQ313 Rat AntiNidogen EnactinG1 Domain Target Antigen Nidogen EnactinG1 Domain Host Isotype Rat IgG2a Application E; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ315 Rat AntiNidogen EnactinG3 Domain Target Antigen Nidogen EnactinG3 Domain Host Isotype Rat IgG2a Application E; WB; Imunquest 50ul (1mg/ml) 427 IQ315 Rat AntiNidogen EnactinG3 Domain Target Antigen Nidogen EnactinG3 Domain Host Isotype Rat IgG2a Application E; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ317 Hamster AntiSerine Protease Inhibitor 2A (Spi2A) Target Antigen Serine Protease Inhibitor 2A (Spi2A) Host Isotype Hamster IgG2b Application IB; Imunquest 50ul (1mg/ml) 427 IQ317 Hamster AntiSerine Protease Inhibitor 2A (Spi2A) Target Antigen Serine Protease Inhibitor 2A (Spi2A) Host Isotype Hamster IgG2b Application IB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ319 Mouse AntiReceptor Tyrosine Phosphatase Beta (phosphacan) Target Antigen Receptor Tyrosine Phosphatase Beta (phosphacan) Host Isotype Mouse IgM Application ICC; IF; IP; WB; Imunquest 50ul (1mg/ml) 427 IQ319 Mouse AntiReceptor Tyrosine Phosphatase Beta (phosphacan) Target Antigen Receptor Tyrosine Phosphatase Beta (phosphacan) Host Isotype Mouse IgM Application ICC; IF; IP; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ321 Mouse AntiNeurocan Target Antigen Neurocan Host Isotype Mouse IgG Application ICC; IF; WB; Imunquest 50ul (1mg/ml) 427 IQ321 Mouse AntiNeurocan Target Antigen Neurocan Host Isotype Mouse IgG Application ICC; IF; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ334 Mouse AntiKallikrein 2 (Hk2) Target Antigen Kallikrein 2 (Hk2) Host Isotype Mouse IgG1 Application E; ICC; IHC Imunquest 50ul (1mg/ml) 427 IQ334 Mouse AntiKallikrein 2 (Hk2) Target Antigen Kallikrein 2 (Hk2) Host Isotype Mouse IgG1 Application E; ICC; IHC Imunquest 50ul (1mg/ml) 427€
ASK
Pub
IQ336 Mouse AntiSigma 54 Target Antigen Sigma 54 Host Isotype Mouse IgG1 kappa Application E; WB; Imunquest 50ul (1mg/ml) 427 IQ336 Mouse AntiSigma 54 Target Antigen Sigma 54 Host Isotype Mouse IgG1 kappa Application E; WB; Imunquest 50ul (1mg/ml) 427€
ASK
Pub
K-2018 AccuPower PCR PreMix 1 ml of 2 X Master mix solution Bioneer 158.5 K-2018 AccuPower PCR PreMix 1 ml of 2 X Master mix solution Bioneer 158.5€ Pub
K-2018-1 AccuPower PCR PreMix 10 ml of 2 X Master mix solution Bioneer 399 K-2018-1 AccuPower PCR PreMix 10 ml of 2 X Master mix solution Bioneer 399€ Pub
K-3032-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ Genomic DNA Extraction kit Bioneer 96-well plate X 2 0 K-3032-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ Genomic DNA Extraction kit Bioneer 96-well plate X 2 0€ Pub
K-6110 AccuPower DualStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests , optical film included Bioneer 50 ul 184 K-6110 AccuPower DualStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests , optical film included Bioneer 50 ul 184€ Pub
K-6111 AccuPower DualStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests , optical film included Bioneer 50 ul 205 K-6111 AccuPower DualStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests , optical film included Bioneer 50 ul 205€ Pub
K-6112 AccuPower DualStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 50 ul 201 K-6112 AccuPower DualStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 50 ul 201€ Pub
K-6113 AccuPower DualStar qPCR PreMix Exicycler 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 184 K-6113 AccuPower DualStar qPCR PreMix Exicycler 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 184€ Pub
K-6114 AccuPower DualStar qPCR PreMix ABI 7500 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 205 K-6114 AccuPower DualStar qPCR PreMix ABI 7500 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 205€ Pub
K-6200 AccuPower GreenStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests, optical film included Bioneer 50 ul 184 K-6200 AccuPower GreenStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests, optical film included Bioneer 50 ul 184€ Pub
K-6201 AccuPower GreenStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests , optical film included Bioneer 50 ul 205 K-6201 AccuPower GreenStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests , optical film included Bioneer 50 ul 205€ Pub
K-6202 AccuPower GreenStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 50 ul 201 K-6202 AccuPower GreenStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 50 ul 201€ Pub
K-6203 AccuPower GreenStar qPCR PreMix Exicycler 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 184 K-6203 AccuPower GreenStar qPCR PreMix Exicycler 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 184€ Pub
K-6204 AccuPower GreenStar qPCR PreMix ABI 7500 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 205 K-6204 AccuPower GreenStar qPCR PreMix ABI 7500 96 well plate, 1 plate 96 tests , optical film included Bioneer 50 ul 205€ Pub
K-7103 AccuPower® DNA Ligation PreMix Bioneer 96 ligations 424 K-7103 AccuPower® DNA Ligation PreMix Bioneer 96 ligations 424€ Pub
K003-H5W Cortisol Enzyme Immunoassay kit 5 Whole plates Arbor Assays 5x96 well plate 806 K003-H5W Cortisol Enzyme Immunoassay kit 5 Whole plates Arbor Assays 5x96 well plate 806€
ASK
Pub
K006-F5 Glutathione Fluorescent Detection Kit (5 plate) Arbor Assays 5x96 well plate 795 K006-F5 Glutathione Fluorescent Detection Kit (5 plate) Arbor Assays 5x96 well plate 795€
ASK
Pub
K014-C5 Corticosterone Chemiluminescent CLIA kit, 5 plates Arbor Assays 5x96 well plate 1019 K014-C5 Corticosterone Chemiluminescent CLIA kit, 5 plates Arbor Assays 5x96 well plate 1019€ Pub
K014-H5 Corticosterone Enzyme Immunoassay kit, 5 plates Arbor Assays 5x96 well plate 830 K014-H5 Corticosterone Enzyme Immunoassay kit, 5 plates Arbor Assays 5x96 well plate 830€ Pub
K017-C5 Cortisone Chemiluminescent CLIA kit (Five Plate) Arbor Assays 5x96 well plate 1231 K017-C5 Cortisone Chemiluminescent CLIA kit (Five Plate) Arbor Assays 5x96 well plate 1231€
ASK
Pub
K018-C5 PGE2 Chemiluminescent Immunoassay kit (Five Plate) Arbor Assays 5x96 well plate 1329 K018-C5 PGE2 Chemiluminescent Immunoassay kit (Five Plate) Arbor Assays 5x96 well plate 1329€
ASK
Pub
K018-H5 PGE2 Enzyme Immunoassay kit (Five Plate) Arbor Assays 5x96 well plate 1016 K018-H5 PGE2 Enzyme Immunoassay kit (Five Plate) Arbor Assays 5x96 well plate 1016€
ASK
Pub
K018-HX5 PGE2 Enzyme Immunoassay High Sensitivity kit (Five Plate) Arbor Assays 5x96 well plate 1016 K018-HX5 PGE2 Enzyme Immunoassay High Sensitivity kit (Five Plate) Arbor Assays 5x96 well plate 1016€
ASK
Pub
K019-C5 Cyclic AMP Direct Chemiluminescent EIA kit (Five Plate) Arbor Assays 5x96 well plate 1192 K019-C5 Cyclic AMP Direct Chemiluminescent EIA kit (Five Plate) Arbor Assays 5x96 well plate 1192€
ASK
Pub
K019-H5 Cyclic AMP Direct EIA Kit (Five Plate) Arbor Assays 5x96 well plate 1016 K019-H5 Cyclic AMP Direct EIA Kit (Five Plate) Arbor Assays 5x96 well plate 1016€
ASK
Pub
K019-H5 Cyclic AMP Total EIA Kit (Five Plate) Arbor Assays 5x96 well plate 1186 K019-H5 Cyclic AMP Total EIA Kit (Five Plate) Arbor Assays 5x96 well plate 1186€
ASK
Pub
K020-C5 Cyclic GMP Direct Chemiluminescent kit (Five Plate) Arbor Assays 5x96 well plate 1329 K020-C5 Cyclic GMP Direct Chemiluminescent kit (Five Plate) Arbor Assays 5x96 well plate 1329€
ASK
Pub
K020-H5 Cyclic GMP Direct EIA kit (Five Plate) Arbor Assays 5x96 well plate 1152 K020-H5 Cyclic GMP Direct EIA kit (Five Plate) Arbor Assays 5x96 well plate 1152€
ASK
Pub
K022-H5 PGFM Enzyme Immunoassay kit (Five Plate) Arbor Assays 5x96 well plate 1007 K022-H5 PGFM Enzyme Immunoassay kit (Five Plate) Arbor Assays 5x96 well plate 1007€ Pub
K025-H5 Progesterone EIA kit (Five Plates) Arbor Assays 5x96 well plate 830 K025-H5 Progesterone EIA kit (Five Plates) Arbor Assays 5x96 well plate 830€ Pub
K026-H5 Atrial Natriuretic Peptide (ANP) EIA kit (Five Plates) Arbor Assays 5x96 well plate 1152 K026-H5 Atrial Natriuretic Peptide (ANP) EIA kit (Five Plates) Arbor Assays 5x96 well plate 1152€ Pub
K030-H5 Estradiol EIA kit (Five Plates) Arbor Assays 5x96 well plate 801 K030-H5 Estradiol EIA kit (Five Plates) Arbor Assays 5x96 well plate 801€ Pub
K031-H5 Estrone EIA kit (Five Plates) Arbor Assays 5x96 well plate 830 K031-H5 Estrone EIA kit (Five Plates) Arbor Assays 5x96 well plate 830€ Pub
K032-H5 Testostrone EIA kit (Five Plates) Arbor Assays 5x96 well plate 853 K032-H5 Testostrone EIA kit (Five Plates) Arbor Assays 5x96 well plate 853€ Pub
K036-H5 Estrone-3-Glucuronide (E1G) EIA Kit (Five Plate) Arbor Assays 5x96 well plate 896 K036-H5 Estrone-3-Glucuronide (E1G) EIA Kit (Five Plate) Arbor Assays 5x96 well plate 896€ Pub
K037-H5 Pregnanediol-3-Glucuronide (PDG) EIA Kit (Five Plate) Arbor Assays 5x96 well plate 896 K037-H5 Pregnanediol-3-Glucuronide (PDG) EIA Kit (Five Plate) Arbor Assays 5x96 well plate 896€ Pub
K038-H5 Estrone-3-Sulfate (E1G) EIA Kit (Five Plate) Arbor Assays 5x96 well plate 1652 K038-H5 Estrone-3-Sulfate (E1G) EIA Kit (Five Plate) Arbor Assays 5x96 well plate 1652€ Pub
K267-50 Cytosol Particulate Separation Kit50 assays Biovision 50 assays 276.885 K267-50 Cytosol Particulate Separation Kit50 assays Biovision 50 assays 276.885€ Pub
K268-50 Membrane Protein Extraction Kit50 assays Biovision 50 assays 314.685 K268-50 Membrane Protein Extraction Kit50 assays Biovision 50 assays 314.685€ Pub
K269-500 Mammalian Cell Extraction Kit500 assays Biovision 500 assays 221.13 K269-500 Mammalian Cell Extraction Kit500 assays Biovision 500 assays 221.13€ Pub
K270-50 FractionPREP Cell Fractionation Kit50 assays Biovision 50 assays 400.68 K270-50 FractionPREP Cell Fractionation Kit50 assays Biovision 50 assays 400.68€ Pub
K410-500 Phosphate Colorimetric Assay Kit500 assays Biovision 500 assays 0 K410-500 Phosphate Colorimetric Assay Kit500 assays Biovision 500 assays 0€ Pub
M1471 5 Carboxy X Rhodamine, NHS Ester, This dye is commonly used in dye terminator sequencing methods by attachment to dideoxynucleotide triphosphates (ddNTP's). It can also be used in other DNA or RNA lab MarkerGene 388 M1471 5 Carboxy X Rhodamine, NHS Ester, This dye is commonly used in dye terminator sequencing methods by attachment to dideoxynucleotide triphosphates (ddNTP's). It can also be used in other DNA or RNA lab MarkerGene 388€
ASK
Pub
MS-0050 Non sterile mouse serum, 50ml Equitech 50 ml 174.3 MS-0050 Non sterile mouse serum, 50ml Equitech 50 ml 174.3€
ASK
Pub
MS-0500 Non sterile mouse serum, 500ml Equitech 500 ml 341.25 MS-0500 Non sterile mouse serum, 500ml Equitech 500 ml 341.25€
ASK
Pub
NBSU-0500 Non sterile newborn calf serum, 500ml Equitech 500 ml 133.35 NBSU-0500 Non sterile newborn calf serum, 500ml Equitech 500 ml 133.35€
ASK
Pub
OS-0500 Non sterile sheep serum, 500ml Equitech 500 ml 192.15 OS-0500 Non sterile sheep serum, 500ml Equitech 500 ml 192.15€
ASK
Pub
PBKXL-10 ProPrep™ Genomic XL-10 High-Throughput Genomic DNA Isolation Kits Biotech support group 10, 10ml whole blood 655 PBKXL-10 ProPrep™ Genomic XL-10 High-Throughput Genomic DNA Isolation Kits Biotech support group 10, 10ml whole blood 655€ Pub
PLF-960 ProPrep™ BAC 960 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group 10x96, 2.0ml cultures 1501 PLF-960 ProPrep™ BAC 960 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group 10x96, 2.0ml cultures 1501€ Pub
PS-0500 Non sterile porcine serum, 500ml Equitech 500 ml 158.55 PS-0500 Non sterile porcine serum, 500ml Equitech 500 ml 158.55€
ASK
Pub
RMS-0050 Non sterile Rhesus monkey serum, 50ml Equitech 50 ml 884.1 RMS-0050 Non sterile Rhesus monkey serum, 50ml Equitech 50 ml 884.1€
ASK
Pub
RMS-0500 Non sterile Rhesus monkey serum, 500ml Equitech 500 ml 6017.55 RMS-0500 Non sterile Rhesus monkey serum, 500ml Equitech 500 ml 6017.55€
ASK
Pub
RTS-0050 Non sterile rat serum, 50ml Equitech 50 ml 193.2 RTS-0050 Non sterile rat serum, 50ml Equitech 50 ml 193.2€
ASK
Pub
RTS-0500 Non sterile rat serum, 500ml Equitech 500 ml 439.95 RTS-0500 Non sterile rat serum, 500ml Equitech 500 ml 439.95€
ASK
Pub
S0200-25 Optional head attachment for 12 x 1.5 2.0 ml tubes, held horizontally Labnet International Inc. 1 95.55 S0200-25 Optional head attachment for 12 x 1.5 2.0 ml tubes, held horizontally Labnet International Inc. 1 95.55€
ASK
Pub
SBCU-0500 Sterile filtered calf serum, 500ml Equitech 500 ml 137.55 SBCU-0500 Sterile filtered calf serum, 500ml Equitech 500 ml 137.55€
ASK
Pub
SBSU-0500 Sterile filtered bovine serum, 500ml Equitech 500 ml 137.55 SBSU-0500 Sterile filtered bovine serum, 500ml Equitech 500 ml 137.55€
ASK
Pub
SC-0500 Sterile filtered chicken serum, 500ml Equitech 500 ml 162.75 SC-0500 Sterile filtered chicken serum, 500ml Equitech 500 ml 162.75€
ASK
Pub
SCA-0500 Sterile filtered canine serum, 500ml Equitech 500 ml 588 SCA-0500 Sterile filtered canine serum, 500ml Equitech 500 ml 588€
ASK
Pub
SCM-0050 Sterile filtered Cynomolgus monkey serum, 50ml Equitech 50 ml 1081.5 SCM-0050 Sterile filtered Cynomolgus monkey serum, 50ml Equitech 50 ml 1081.5€
ASK
Pub
SCM-0500 Sterile filtered Cynomolgus monkey serum, 500ml Equitech 500 ml 7498.05 SCM-0500 Sterile filtered Cynomolgus monkey serum, 500ml Equitech 500 ml 7498.05€
ASK
Pub
SD-0500 Sterile filtered donkey serum, 500ml Equitech 500 ml 162.75 SD-0500 Sterile filtered donkey serum, 500ml Equitech 500 ml 162.75€
ASK
Pub
SE-0500 Sterile filtered equine serum, 500ml Equitech 500 ml 162.75 SE-0500 Sterile filtered equine serum, 500ml Equitech 500 ml 162.75€
ASK
Pub
SF-0500 Sterile filtered feline serum, 500ml Equitech 500 ml 1081.5 SF-0500 Sterile filtered feline serum, 500ml Equitech 500 ml 1081.5€
ASK
Pub
SFBA-0050 Sterile filtered fetal bovine serum, 50ml Equitech 50 ml 121.8 SFBA-0050 Sterile filtered fetal bovine serum, 50ml Equitech 50 ml 121.8€
ASK
Pub
SFBA-0500 Sterile filtered fetal bovine seru, 500ml Equitech 500 ml 322.35 SFBA-0500 Sterile filtered fetal bovine seru, 500ml Equitech 500 ml 322.35€
ASK
Pub
SFBIU-0050 Sterile filtered fetal bovine serum, low IgG,50ml Equitech 50 ml 142.8 SFBIU-0050 Sterile filtered fetal bovine serum, low IgG,50ml Equitech 50 ml 142.8€
ASK
Pub
SFBIU-0050HI Sterile filtered fetal bovine serum, low IgG, 50ml, heat inactivated Equitech 50 ml 145.95 SFBIU-0050HI Sterile filtered fetal bovine serum, low IgG, 50ml, heat inactivated Equitech 50 ml 145.95€
ASK
Pub
SFBIU-0500 Sterile filtered fetal bovine serum, low IgG, 500ml Equitech 500 ml 469.35 SFBIU-0500 Sterile filtered fetal bovine serum, low IgG, 500ml Equitech 500 ml 469.35€
ASK
Pub
SFBIU-0500HI Sterile filtered fetal bovine serum, low IgG, 500ml, heat inactivated Equitech 500 ml 472.5 SFBIU-0500HI Sterile filtered fetal bovine serum, low IgG, 500ml, heat inactivated Equitech 500 ml 472.5€
ASK
Pub
SFBM-0050 Sterile filtered fetal bovine serum, 50ml Equitech 50 ml 120.75 SFBM-0050 Sterile filtered fetal bovine serum, 50ml Equitech 50 ml 120.75€
ASK
Pub
SFBM-0050HI Sterile filtered fetal bovine serum, 50ml, heat inactivated Equitech 50 ml 123.9 SFBM-0050HI Sterile filtered fetal bovine serum, 50ml, heat inactivated Equitech 50 ml 123.9€
ASK
Pub
SFBM-0500 Sterile filtered fetal bovine serum, 500ml Equitech 500 ml 298.2 SFBM-0500 Sterile filtered fetal bovine serum, 500ml Equitech 500 ml 298.2€
ASK
Pub
SFBM-0500HI Sterile filtered fetal bovine serum, 500ml, heat inactivated Equitech 500 ml 301.35 SFBM-0500HI Sterile filtered fetal bovine serum, 500ml, heat inactivated Equitech 500 ml 301.35€
ASK
Pub
SFBMC-0500 Sterile filtered fetal bovine serum, charcoal stripped, 500ml Equitech 500 ml 427.35 SFBMC-0500 Sterile filtered fetal bovine serum, charcoal stripped, 500ml Equitech 500 ml 427.35€
ASK
Pub
SFBMC-0500HI Sterile filtered fetal bovine serum, charcoal stripped, 500ml, heat inactivated Equitech 500 ml 430.5 SFBMC-0500HI Sterile filtered fetal bovine serum, charcoal stripped, 500ml, heat inactivated Equitech 500 ml 430.5€
ASK
Pub
SFBMDY-0500 Sterile filtered fetal bovine serum, dialyzed, 500ml Equitech 500 ml 427.35 SFBMDY-0500 Sterile filtered fetal bovine serum, dialyzed, 500ml Equitech 500 ml 427.35€
ASK
Pub
SFBMDY-0500HI Sterile filtered fetal bovine serum, dialyzed, 500ml, heat inactivated Equitech 500 ml 430.5 SFBMDY-0500HI Sterile filtered fetal bovine serum, dialyzed, 500ml, heat inactivated Equitech 500 ml 430.5€
ASK
Pub
SFBU-0050 Sterile filtered fetal bovine serum, 50ml Equitech 50 ml 121.8 SFBU-0050 Sterile filtered fetal bovine serum, 50ml Equitech 50 ml 121.8€
ASK
Pub
SFBU-0050HI Sterile filtered fetal bovine serum, 50ml, heat inactivated Equitech 50 ml 124.95 SFBU-0050HI Sterile filtered fetal bovine serum, 50ml, heat inactivated Equitech 50 ml 124.95€
ASK
Pub
SFBU-0500 Sterile filtered fetal bovine serum, 500ml Equitech 500 ml 322.35 SFBU-0500 Sterile filtered fetal bovine serum, 500ml Equitech 500 ml 322.35€
ASK
Pub
SFBU-0500GI Sterile filtered fetal bovine serum, 500ml gamma irradiated Equitech 500 ml 340.2 SFBU-0500GI Sterile filtered fetal bovine serum, 500ml gamma irradiated Equitech 500 ml 340.2€
ASK
Pub
SFBU-0500HI Sterile filtered fetal bovine serum, 500ml, heat inactivated Equitech 500 ml 325.5 SFBU-0500HI Sterile filtered fetal bovine serum, 500ml, heat inactivated Equitech 500 ml 325.5€
ASK
Pub
SFBUC-0500 Sterile filtered fetal bovine serum, charcoal stripped, 500ml Equitech 500 ml 467.25 SFBUC-0500 Sterile filtered fetal bovine serum, charcoal stripped, 500ml Equitech 500 ml 467.25€
ASK
Pub
SFBUC-0500HI Sterile filtered fetal bovine serum, charcoal stripped,500ml, heat inactivated Equitech 500 ml 470.4 SFBUC-0500HI Sterile filtered fetal bovine serum, charcoal stripped,500ml, heat inactivated Equitech 500 ml 470.4€
ASK
Pub
SFBUDY-0500 Sterile filtered fetal bovine serum, dialyzed, 500ml Equitech 500 ml 467.25 SFBUDY-0500 Sterile filtered fetal bovine serum, dialyzed, 500ml Equitech 500 ml 467.25€
ASK
Pub
SG-0500 Sterile filtered goat serum, 500ml Equitech 500 ml 162.75 SG-0500 Sterile filtered goat serum, 500ml Equitech 500 ml 162.75€
ASK
Pub
SGP-0050 Sterile filtered guinea pig serum, 50ml Equitech 50 ml 217.35 SGP-0050 Sterile filtered guinea pig serum, 50ml Equitech 50 ml 217.35€
ASK
Pub
SGP-0500 Sterile filtered guinea pig serum, 500ml Equitech 500 ml 649.95 SGP-0500 Sterile filtered guinea pig serum, 500ml Equitech 500 ml 649.95€
ASK
Pub
SHA-0050 Sterile filtered hamster serum, 50ml Equitech 50 ml 248.85 SHA-0050 Sterile filtered hamster serum, 50ml Equitech 50 ml 248.85€
ASK
Pub
SHA-0500 Sterile filtered hamster serum, 500ml Equitech 500 ml 711.9 SHA-0500 Sterile filtered hamster serum, 500ml Equitech 500 ml 711.9€
ASK
Pub
SHAPC-0050 Sterile filtered hamster plasma with sodium citrate, 50ml Equitech 50 ml 249 SHAPC-0050 Sterile filtered hamster plasma with sodium citrate, 50ml Equitech 50 ml 249€
ASK
Pub
SHAPE-0050 Sterile filtered hamster plasma with EDTA, 50ml Equitech 50 ml 249 SHAPE-0050 Sterile filtered hamster plasma with EDTA, 50ml Equitech 50 ml 249€
ASK
Pub
SHAPH-0050 Sterile filtered hamster plasma with heparin, 50ml Equitech 50 ml 249 SHAPH-0050 Sterile filtered hamster plasma with heparin, 50ml Equitech 50 ml 249€
ASK
Pub
SM-0050 Sterile filtered mouse serum, 50ml Equitech 50 ml 186.9 SM-0050 Sterile filtered mouse serum, 50ml Equitech 50 ml 186.9€
ASK
Pub
SM-0500 Sterile filtered mouse serum, 500ml Equitech 500 ml 414.75 SM-0500 Sterile filtered mouse serum, 500ml Equitech 500 ml 414.75€
ASK
Pub
SNBU-0500 Sterile filtered newborn calf serum, 500ml Equitech 500 ml 142.8 SNBU-0500 Sterile filtered newborn calf serum, 500ml Equitech 500 ml 142.8€
ASK
Pub
SRM-0050 Sterile filtered Rhesus monkey serum, 50ml Equitech 50 ml 884.1 SRM-0050 Sterile filtered Rhesus monkey serum, 50ml Equitech 50 ml 884.1€
ASK
Pub
SRM-0500 Sterile filtered Rhesus monkey serum, 500ml Equitech 500 ml 6017.55 SRM-0500 Sterile filtered Rhesus monkey serum, 500ml Equitech 500 ml 6017.55€
ASK
Pub
SRT-0050 Sterile filtered rat serum, 50ml Equitech 50 ml 217.35 SRT-0050 Sterile filtered rat serum, 50ml Equitech 50 ml 217.35€
ASK
Pub
SS-0500 Sterile filtered sheep serum, 500ml Equitech 500 ml 205.8 SS-0500 Sterile filtered sheep serum, 500ml Equitech 500 ml 205.8€
ASK
Pub
TC32/80 CSL Thermal Cycler with CombiBlock for 0.2ml and 0.5ml tubes Cleaver 1 4050 TC32/80 CSL Thermal Cycler with CombiBlock for 0.2ml and 0.5ml tubes Cleaver 1 4050€
ASK
Pub
TVT-03-50 50 x 3ml Vacuum Blood Collection Tubes containing K3EDTA & TransFix Cytomark 446.25 TVT-03-50 50 x 3ml Vacuum Blood Collection Tubes containing K3EDTA & TransFix Cytomark 446.25€ Pub
  OP-0001-3  EpiQuik Superoxide Dismutase Activity Inhibition Assay Kit (Colorimetric) (5x96 assays) EpigenTek 397   OP-0001-3  EpiQuik Superoxide Dismutase Activity Inhibition Assay Kit (Colorimetric) (5x96 assays) EpigenTek 397€
ASK
Pub
  OP-0004-2  CytoX Red Cell Proliferation Cytotoxicity Assay Kit (5x96 assays) EpigenTek 214   OP-0004-2  CytoX Red Cell Proliferation Cytotoxicity Assay Kit (5x96 assays) EpigenTek 214€
ASK
Pub
  OP-0005-1  CytoX Violet Cell Proliferation Cytotoxicity Assay Kit (5x96 assays) EpigenTek 174   OP-0005-1  CytoX Violet Cell Proliferation Cytotoxicity Assay Kit (5x96 assays) EpigenTek 174€
ASK
Pub
BAB100-0050 Borellia grade BSA powder, Borellia and Leptospira growth tested, 50gm Equitech 238.76 BAB100-0050 Borellia grade BSA powder, Borellia and Leptospira growth tested, 50gm Equitech 238.76€
ASK
Pub
BAB100-0500 Borellia grade BSA powder, Borellia and Leptospira growth tested, 500gm Equitech 490.44 BAB100-0500 Borellia grade BSA powder, Borellia and Leptospira growth tested, 500gm Equitech 490.44€
ASK
Pub
BAC61-0050 Fraction V Microbiological grade BSA powder, 50gm Equitech 193 BAC61-0050 Fraction V Microbiological grade BSA powder, 50gm Equitech 193€
ASK
Pub
BAC61-0500 Fraction V Microbiological grade BSA powder, 500gm Equitech 364.6 BAC61-0500 Fraction V Microbiological grade BSA powder, 500gm Equitech 364.6€
ASK
Pub
BAC62-0050 Fraction V BSA powder, pH 7, 50gm Equitech 221.6 BAC62-0050 Fraction V BSA powder, pH 7, 50gm Equitech 221.6€
ASK
Pub
BAC62-0500 Fraction V BSA powder, pH 7, 500gm Equitech 450.4 BAC62-0500 Fraction V BSA powder, pH 7, 500gm Equitech 450.4€
ASK
Pub
BAC63-0050 Fraction V BSA powder, pH 5.2, 50gm Equitech 206 BAC63-0050 Fraction V BSA powder, pH 5.2, 50gm Equitech 206€
ASK
Pub
BAC63-0500 Fraction V BSA powder, pH 5.2, 500gm Equitech 414 BAC63-0500 Fraction V BSA powder, pH 5.2, 500gm Equitech 414€
ASK
Pub
BAC65-0050 Fraction V BSA powder, protease free, 50gm Equitech 250.2 BAC65-0050 Fraction V BSA powder, protease free, 50gm Equitech 250.2€
ASK
Pub
BAC65-0500 Fraction V BSA powder, protease free, 500gm Equitech 479 BAC65-0500 Fraction V BSA powder, protease free, 500gm Equitech 479€
ASK
Pub
BAH-0050 Low endotoxin heat shock BSA powder, 50gm Equitech 206 BAH-0050 Low endotoxin heat shock BSA powder, 50gm Equitech 206€
ASK
Pub
BAH-0500 Low endotoxin heat shock BSA powder, 500gm Equitech 362 BAH-0500 Low endotoxin heat shock BSA powder, 500gm Equitech 362€
ASK
Pub
BAH62-0050 Standard grade heat shock BSA powder, pH 7, 50gm Equitech 154 BAH62-0050 Standard grade heat shock BSA powder, pH 7, 50gm Equitech 154€
ASK
Pub
BAH62-0500 Standard grade heat shock BSA powder, pH 7, 500gm Equitech 310 BAH62-0500 Standard grade heat shock BSA powder, pH 7, 500gm Equitech 310€
ASK
Pub
BAH63-0050 Standard grade heat shock BSA powder, pH 5.2, 50gm Equitech 154 BAH63-0050 Standard grade heat shock BSA powder, pH 5.2, 50gm Equitech 154€
ASK
Pub
BAH63-0500 Standard grade heat shock BSA powder, pH 5.2, 500gm Equitech 310 BAH63-0500 Standard grade heat shock BSA powder, pH 5.2, 500gm Equitech 310€
ASK
Pub
BAH64-0050 Reagent grade heat shock BSA powder, 50gm Equitech 206 BAH64-0050 Reagent grade heat shock BSA powder, 50gm Equitech 206€
ASK
Pub
BAH64-0500 Reagent grade heat shock BSA powder, 500gm Equitech 336 BAH64-0500 Reagent grade heat shock BSA powder, 500gm Equitech 336€
ASK
Pub
BAH65-0050 Protease free heat shock BSA powder, 50gm Equitech 180 BAH65-0050 Protease free heat shock BSA powder, 50gm Equitech 180€
ASK
Pub
BAH65-0500 Protease free heat shock BSA powder, 500gm Equitech 336 BAH65-0500 Protease free heat shock BSA powder, 500gm Equitech 336€
ASK
Pub
BAH66-0050 Fatty acid free heat shock BSA powder, 50gm Equitech 250.2 BAH66-0050 Fatty acid free heat shock BSA powder, 50gm Equitech 250.2€
ASK
Pub
BAH66-0500 Fatty acid free heat shock BSA powder, 500gm Equitech 479 BAH66-0500 Fatty acid free heat shock BSA powder, 500gm Equitech 479€
ASK
Pub
BAH67-0100 Protease, DNASE free heat shock BSA powder, 100gm Equitech 310 BAH67-0100 Protease, DNASE free heat shock BSA powder, 100gm Equitech 310€
ASK
Pub
BCSU-0500 Non-sterile calf serum, 500ml Equitech 79.12 BCSU-0500 Non-sterile calf serum, 500ml Equitech 79.12€
ASK
Pub
BL63-0500 Fraction V 30% BSA solution, 500ml Equitech 221 BL63-0500 Fraction V 30% BSA solution, 500ml Equitech 221€
ASK
Pub
BPUC-0500 Non-sterile bovine plasma with sodium citrate, 500ml Equitech 82.76 BPUC-0500 Non-sterile bovine plasma with sodium citrate, 500ml Equitech 82.76€
ASK
Pub
BSU-0500 Non-sterile bovine serum, 500ml Equitech 79.12 BSU-0500 Non-sterile bovine serum, 500ml Equitech 79.12€
ASK
Pub
CAS-0500 Non-sterile canine serum, 500ml Equitech 382.8 CAS-0500 Non-sterile canine serum, 500ml Equitech 382.8€
ASK
Pub
CASA-0500 Canine serum albumin lyophilized powder, 500mg Equitech 934 CASA-0500 Canine serum albumin lyophilized powder, 500mg Equitech 934€
ASK
Pub
CMPC-0050 Non-sterile Cynomolgus monkey plasma with sodium citrate,50ml Equitech 798.8 CMPC-0050 Non-sterile Cynomolgus monkey plasma with sodium citrate,50ml Equitech 798.8€
ASK
Pub
CMPC-0500 Non-sterile Cynomolgus monkey plasma with sodium citrate, 500ml Equitech 5666 CMPC-0500 Non-sterile Cynomolgus monkey plasma with sodium citrate, 500ml Equitech 5666€
ASK
Pub
CMPE-0050 Non-sterile Cynomolgus monkey plasma with EDTA, 50ml Equitech 798.8 CMPE-0050 Non-sterile Cynomolgus monkey plasma with EDTA, 50ml Equitech 798.8€
ASK
Pub
CMPE-0500 Non-sterile Cynomolgus monkey plasma with EDTA, 500ml Equitech 5666 CMPE-0500 Non-sterile Cynomolgus monkey plasma with EDTA, 500ml Equitech 5666€
ASK
Pub
CMPH-0050 Non-sterile Cynomolgus monkey plasma with heparin, 50ml Equitech 798.8 CMPH-0050 Non-sterile Cynomolgus monkey plasma with heparin, 50ml Equitech 798.8€
ASK
Pub
CMPH-0500 Non-sterile Cynomolgus monkey plasma with heparin, 500ml Equitech 5666 CMPH-0500 Non-sterile Cynomolgus monkey plasma with heparin, 500ml Equitech 5666€
ASK
Pub
CMS-0050 Non-sterile Cynomolgus monkey serum, 50ml Equitech 715.6 CMS-0050 Non-sterile Cynomolgus monkey serum, 50ml Equitech 715.6€
ASK
Pub
CMS-0500 Non-sterile Cynomolgus monkey serum, 500ml Equitech 5042 CMS-0500 Non-sterile Cynomolgus monkey serum, 500ml Equitech 5042€
ASK
Pub
CPP500 CRF Anti-Polyvalent HRP Polymer (DAB) Lab Pack Scy tek 5000 Slides 4195 CPP500 CRF Anti-Polyvalent HRP Polymer (DAB) Lab Pack Scy tek 5000 Slides 4195€
ASK
Pub
EAP500 EconoTek Alk-Phos Anti-Polyvalent Lab Pack Scy tek 5000 Slides 576 EAP500 EconoTek Alk-Phos Anti-Polyvalent Lab Pack Scy tek 5000 Slides 576€
ASK
Pub
EHP500 EconoTek HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 533 EHP500 EconoTek HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 533€
ASK
Pub
Rlp500 Retrieval HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 1181 Rlp500 Retrieval HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 1181€
ASK
Pub
SAM500 SensiTek Alk-Phos Anti-Mouse Lab Pack Scy tek 5000 Slides 674 SAM500 SensiTek Alk-Phos Anti-Mouse Lab Pack Scy tek 5000 Slides 674€
ASK
Pub
SAP500 SensiTek Alk-Phos Anti-Polyvalent Lab Pack Scy tek 5000 Slides 744 SAP500 SensiTek Alk-Phos Anti-Polyvalent Lab Pack Scy tek 5000 Slides 744€
ASK
Pub
SAR500 SensiTek Alk-Phos Anti-Rabbit Lab Pack Scy tek 5000 Slides 674 SAR500 SensiTek Alk-Phos Anti-Rabbit Lab Pack Scy tek 5000 Slides 674€
ASK
Pub
SG-0500 Sterile filtered goat serum, 0.2 micron, 500ml Equitech 112 SG-0500 Sterile filtered goat serum, 0.2 micron, 500ml Equitech 112€
ASK
Pub
SG-0500HI Sterile filtered goat serum, 0.2 micron, 500ml, heat inactivated Equitech 118 SG-0500HI Sterile filtered goat serum, 0.2 micron, 500ml, heat inactivated Equitech 118€
ASK
Pub
SHM500 SensiTek HRP Anti-Mouse Lab Pack Scy tek 5000 Slides 624 SHM500 SensiTek HRP Anti-Mouse Lab Pack Scy tek 5000 Slides 624€
ASK
Pub
SHP500 SensiTek HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 684 SHP500 SensiTek HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 684€
ASK
Pub
SHR500 SensiTek HRP Anti-Rabbit Lab Pack Scy tek 5000 Slides 624 SHR500 SensiTek HRP Anti-Rabbit Lab Pack Scy tek 5000 Slides 624€
ASK
Pub
UAM500 UltraTek Alk-Phos Anti-Mouse Lab Pack Scy tek 5000 Slides 1181 UAM500 UltraTek Alk-Phos Anti-Mouse Lab Pack Scy tek 5000 Slides 1181€
ASK
Pub
UAP500 UltraTek Alk-Phos Anti-Polyvalent Lab Pack Scy tek 5000 Slides 1708 UAP500 UltraTek Alk-Phos Anti-Polyvalent Lab Pack Scy tek 5000 Slides 1708€
ASK
Pub
UAR500 UltraTek Alk-Phos Anti-Rabbit Lab Pack Scy tek 5000 Slides 1181 UAR500 UltraTek Alk-Phos Anti-Rabbit Lab Pack Scy tek 5000 Slides 1181€
ASK
Pub
UHM500 UltraTek HRP Anti-Mouse Lab Pack Scy tek 5000 Slides 850 UHM500 UltraTek HRP Anti-Mouse Lab Pack Scy tek 5000 Slides 850€
ASK
Pub
UHP500 UltraTek HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 1067 UHP500 UltraTek HRP Anti-Polyvalent Lab Pack Scy tek 5000 Slides 1067€
ASK
Pub
UHR500 UltraTek HRP Anti-Rabbit Lab Pack Scy tek 5000 Slides 850 UHR500 UltraTek HRP Anti-Rabbit Lab Pack Scy tek 5000 Slides 850€
ASK
Pub
0-121-0002 Model 150 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2218 0-121-0002 Model 150 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2218€
ASK
Pub
0-121-0002 ULTRASONIC HOMOGENIZERS: Model 150 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2203 0-121-0002 ULTRASONIC HOMOGENIZERS: Model 150 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2203€
ASK
Pub
0-122-0002 Model 300 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2878 0-122-0002 Model 300 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2878€
ASK
Pub
0-122-0002 ULTRASONIC HOMOGENIZERS: Model 300 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2858 0-122-0002 ULTRASONIC HOMOGENIZERS: Model 300 V T Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 2858€
ASK
Pub
0-127-0002 Model 3000 Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 3373 0-127-0002 Model 3000 Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 3373€ Pub
0-128-0002 ULTRASONIC HOMOGENIZERS: Model 3000MP Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 3814 0-128-0002 ULTRASONIC HOMOGENIZERS: Model 3000MP Ultrasonic Homogenizer, 230V 50Hz BioLogics,Inc 3814€
ASK
Pub
000493A DNASE I ABM Goods 250ul 621 000493A DNASE I ABM Goods 250ul 621€
ASK
Pub
000678A mTOR1 (1 524a.a.) ABM Goods 250ul 621 000678A mTOR1 (1 524a.a.) ABM Goods 250ul 621€
ASK
Pub
000782A mLin28 ABM Goods 250ul 1659 000782A mLin28 ABM Goods 250ul 1659€
ASK
Pub
001-03 ACTH [D Arg8](4 10)(Human) 500ug Phoenix Peptide 500 µg 192 001-03 ACTH [D Arg8](4 10)(Human) 500ug Phoenix Peptide 500 µg 192€
ASK
Pub
010-19771 Anti VGLUT-1 Rat, polyclonal, Rabbit Antibodies B-Bridge 50UG 526.5 010-19771 Anti VGLUT-1 Rat, polyclonal, Rabbit Antibodies B-Bridge 50UG 526.5€
ASK
Pub
010-19771 Anti VGLUT 1 Rat, polyclonal, Rabbit B-Bridge 50UG 594.678 010-19771 Anti VGLUT 1 Rat, polyclonal, Rabbit B-Bridge 50UG 594.678€
ASK
Pub
011-22033 Anti AGO2 Human, Monoclonal Antibody B-Bridge 50ul 594.678 011-22033 Anti AGO2 Human, Monoclonal Antibody B-Bridge 50ul 594.678€
ASK
Pub
011-22033 Anti AGO2 Human, Monoclonal Antibody Antibodies B-Bridge 50ul 526.5 011-22033 Anti AGO2 Human, Monoclonal Antibody Antibodies B-Bridge 50ul 526.5€
ASK
Pub
014-22023 Anti AGO2 Mouse, Monoclonal Antibody B-Bridge 50ul 594.678 014-22023 Anti AGO2 Mouse, Monoclonal Antibody B-Bridge 50ul 594.678€
ASK
Pub
014-22023 Anti AGO2 Mouse, Monoclonal Antibody Antibodies B-Bridge 50ul 526.5 014-22023 Anti AGO2 Mouse, Monoclonal Antibody Antibodies B-Bridge 50ul 526.5€
ASK
Pub
015-22411 Anti Ago1, Monoclonal Antibody (2A7) Antibodies B-Bridge 50ul 526.5 015-22411 Anti Ago1, Monoclonal Antibody (2A7) Antibodies B-Bridge 50ul 526.5€
ASK
Pub
017-19781 Anti Rat VGLUT-2, Rabbit Antibodies B-Bridge 50UG 526.5 017-19781 Anti Rat VGLUT-2, Rabbit Antibodies B-Bridge 50UG 526.5€
ASK
Pub
017-19781 Anti Rat VGLUT 2, Rabbit B-Bridge 50UG 594.678 017-19781 Anti Rat VGLUT 2, Rabbit B-Bridge 50UG 594.678€
ASK
Pub
018-22401 Anti Ago1, Monoclonal Antibody (1F2) Antibodies B-Bridge 50ul 526.5 018-22401 Anti Ago1, Monoclonal Antibody (1F2) Antibodies B-Bridge 50ul 526.5€
ASK
Pub
018-23241 Anti Human AGO3, Monoclonal Antibody (1C12) Antibodies B-Bridge 50ul 526.5 018-23241 Anti Human AGO3, Monoclonal Antibody (1C12) Antibodies B-Bridge 50ul 526.5€
ASK
Pub
02267-41 Signal Enhancer HIKARI for Western Blotting and ELISA (50ml) Nacalai 1SET 182 02267-41 Signal Enhancer HIKARI for Western Blotting and ELISA (50ml) Nacalai 1SET 182€
ASK
Pub
05176-25 RPMI 1640 without L‐Gln, liquid Nacalai 500ML 118 05176-25 RPMI 1640 without L‐Gln, liquid Nacalai 500ML 118€ Pub
10-174 0.2ml Thin Wall PCR Tubes Genesee 117 10-174 0.2ml Thin Wall PCR Tubes Genesee 117€
ASK
Pub
1085-100 Active Human Caspase 5100 units Biovision 100 units 295.785 1085-100 Active Human Caspase 5100 units Biovision 100 units 295.785€
ASK
Pub
11009 PTEN(Phospho-Ser380) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11009 PTEN(Phospho-Ser380) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11011 NFκB-p65(Phospho-Ser276) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11011 NFκB-p65(Phospho-Ser276) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11012 NFκB-p65(Phospho-Thr435) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB IHC SignalWay Antibody S.A.B 50ul 224 11012 NFκB-p65(Phospho-Thr435) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB IHC SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11013 NFκB-p65(Phospho-Ser468) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11013 NFκB-p65(Phospho-Ser468) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11015 NFκB-p100 p52(Phospho-Ser866) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11015 NFκB-p100 p52(Phospho-Ser866) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11016 NFκB-p100 p52(Phospho-Ser870) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11016 NFκB-p100 p52(Phospho-Ser870) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11017 NFκB-p105 p50(Phospho-Ser337) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11017 NFκB-p105 p50(Phospho-Ser337) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11018 NFκB-p105 p50(Phospho-Ser893) Antibody, Rabbit Polyconal Ab, Human SignalWay Antibody S.A.B 50ul 190 11018 NFκB-p105 p50(Phospho-Ser893) Antibody, Rabbit Polyconal Ab, Human SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11019 NFκB-p105 p50(Phospho-Ser907) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human SignalWay Antibody S.A.B 50ul 190 11019 NFκB-p105 p50(Phospho-Ser907) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11043 HNF4α (Phospho-Ser304) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 224 11043 HNF4α (Phospho-Ser304) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11062 PTEN(Phospho-Ser370) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11062 PTEN(Phospho-Ser370) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11066 BCL-XL(Phospho-Ser62) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11066 BCL-XL(Phospho-Ser62) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11087 IGF-1R(Phospho-Tyr1161) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11087 IGF-1R(Phospho-Tyr1161) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11091 Src(Phospho-Tyr418) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11091 Src(Phospho-Tyr418) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11125 c-Abl(Phospho-Tyr412) Antibody, Rabbit Polyconal Ab, Human Mouse SignalWay Antibody S.A.B 50ul 190 11125 c-Abl(Phospho-Tyr412) Antibody, Rabbit Polyconal Ab, Human Mouse SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11150 JAK2(Phospho-Tyr221) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11150 JAK2(Phospho-Tyr221) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11157 FKHRL1(Phospho-Ser253) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11157 FKHRL1(Phospho-Ser253) Antibody, Source: Rabbit Polyconal Ab, Species reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
11188 Ephrin-B2 (Phospho-Tyr316) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224 11188 Ephrin-B2 (Phospho-Tyr316) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11189 Ephrin-B2 (Phospho-Tyr330) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224 11189 Ephrin-B2 (Phospho-Tyr330) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11211 Tyrosine Hydroxylase (Phospho-Ser31) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 224 11211 Tyrosine Hydroxylase (Phospho-Ser31) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11215 FAK (Phospho-Tyr397) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 224 11215 FAK (Phospho-Tyr397) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11241 SP1 (Phospho-Thr739) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 224 11241 SP1 (Phospho-Thr739) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11330 α-catenin (Phospho-Ser641) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224 11330 α-catenin (Phospho-Ser641) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11531 VEGFR2 (phospho-Tyr1059) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224 11531 VEGFR2 (phospho-Tyr1059) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11536 Stat2 (phospho-Tyr690) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 224 11536 Stat2 (phospho-Tyr690) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11541 Cyclin E1 (phospho-Thr395) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 224 11541 Cyclin E1 (phospho-Thr395) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11558 Interferon-a Receptor Type I Subunit I (phospho-Ser535 Ser539) Antibody, Rabbit Polyconal Ab, Species Reactivity: Human SignalWay Antibody S.A.B 50ul 214 11558 Interferon-a Receptor Type I Subunit I (phospho-Ser535 Ser539) Antibody, Rabbit Polyconal Ab, Species Reactivity: Human SignalWay Antibody S.A.B 50ul 214€
ASK
Pub
11568 Synapsin (phospho-Ser549) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 224 11568 Synapsin (phospho-Ser549) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11570 Tau (phospho-Ser416) Antibody Source Rabbit Polyconal Ab Species Rat Application WB SignalWay Antibody S.A.B 50ul 224 11570 Tau (phospho-Ser416) Antibody Source Rabbit Polyconal Ab Species Rat Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11572 CK2α (phospho-Thr360 Ser362) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 224 11572 CK2α (phospho-Thr360 Ser362) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11574 β-catenin (phospho-Tyr333) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 224 11574 β-catenin (phospho-Tyr333) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 224€
ASK
Pub
11578 Niban (Phospho-Ser602) Antibody, Rabbit Polyconal Ab, Species Reactivity: Human SignalWay Antibody S.A.B 50ul 214 11578 Niban (Phospho-Ser602) Antibody, Rabbit Polyconal Ab, Species Reactivity: Human SignalWay Antibody S.A.B 50ul 214€
ASK
Pub
11579 Smad1 (Phospho-Ser206) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214 11579 Smad1 (Phospho-Ser206) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214€
ASK
Pub
11580 S6 Ribosomal Protein (Phospho-Ser235 236) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214 11580 S6 Ribosomal Protein (Phospho-Ser235 236) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214€
ASK
Pub
11581 P38 MAPK(Phospho-Thr180 Tyr182) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214 11581 P38 MAPK(Phospho-Thr180 Tyr182) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214€
ASK
Pub
11582 Histone H3 (Tri-Methyl-Lys27) Antibody, Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214 11582 Histone H3 (Tri-Methyl-Lys27) Antibody, Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214€
ASK
Pub
11583 Histone H3 (Di-Methyl-Lys27) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214 11583 Histone H3 (Di-Methyl-Lys27) Antibody , Rabbit Polyconal Ab, Species Reactivity: Human Mouse Rat SignalWay Antibody S.A.B 50ul 214€
ASK
Pub
11585 Met (Phospho-Tyr1234 1235) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190 11585 Met (Phospho-Tyr1234 1235) Antibody, Rabbit Polyconal Ab, Human Mouse Rat SignalWay Antibody S.A.B 50ul 190€
ASK
Pub
14-262 1.2ml Microtitertube Racked, Sterile Genesee 10 Racks of 96 Tubes/Unit 90 14-262 1.2ml Microtitertube Racked, Sterile Genesee 10 Racks of 96 Tubes/Unit 90€
ASK
Pub
1614-1 BMS-599626; Appearance Crystalline solid Biovision 1 mg 353.43 1614-1 BMS-599626; Appearance Crystalline solid Biovision 1 mg 353.43€ Pub
1614-1 BMS 599626 Biovision 1 mg 353 1614-1 BMS 599626 Biovision 1 mg 353€ Pub
1614-5 BMS-599626; Appearance Crystalline solid Biovision 5 mg 977.13 1614-5 BMS-599626; Appearance Crystalline solid Biovision 5 mg 977.13€ Pub
1614-5 BMS 599626 Biovision 5 mg 977 1614-5 BMS 599626 Biovision 5 mg 977€ Pub
1624-100 Lapatinib Ditosylate (Tykerb, Tyverb, GW-572016); Appearance Yellow solid Biovision 100 mg 353.43 1624-100 Lapatinib Ditosylate (Tykerb, Tyverb, GW-572016); Appearance Yellow solid Biovision 100 mg 353.43€ Pub
1624-100 Lapatinib Ditosylate (Tykerb, Tyverb, GW 572016) Biovision 100 mg 353 1624-100 Lapatinib Ditosylate (Tykerb, Tyverb, GW 572016) Biovision 100 mg 353€ Pub
1624-25 Lapatinib Ditosylate (Tykerb, Tyverb, GW-572016); Appearance Yellow solid Biovision 25 mg 177.66 1624-25 Lapatinib Ditosylate (Tykerb, Tyverb, GW-572016); Appearance Yellow solid Biovision 25 mg 177.66€ Pub
1624-25 Lapatinib Ditosylate (Tykerb, Tyverb, GW 572016) Biovision 25 mg 176 1624-25 Lapatinib Ditosylate (Tykerb, Tyverb, GW 572016) Biovision 25 mg 176€ Pub
1625-100 Imatinib Mesylate (CGP-57148B, STI-571); Appearance White to off-white solid Biovision 100 mg 136.08 1625-100 Imatinib Mesylate (CGP-57148B, STI-571); Appearance White to off-white solid Biovision 100 mg 136.08€ Pub
1625-100 Imatinib Mesylate (CGP 57148B, STI 571) Biovision 100 mg 135 1625-100 Imatinib Mesylate (CGP 57148B, STI 571) Biovision 100 mg 135€ Pub
1625-1000 Imatinib Mesylate (CGP-57148B, STI-571); Appearance White to off-white solid Biovision 1 g 385.56 1625-1000 Imatinib Mesylate (CGP-57148B, STI-571); Appearance White to off-white solid Biovision 1 g 385.56€ Pub
1625-1000 Imatinib Mesylate (CGP 57148B, STI 571) Biovision 1 g 384 1625-1000 Imatinib Mesylate (CGP 57148B, STI 571) Biovision 1 g 384€ Pub
1645-05 SU 5402 Biovision 500 µg 197 1645-05 SU 5402 Biovision 500 µg 197€ Pub
1685-5 ATM Kinase Inhibitor, KU-55933 Biovision 5 mg 211 1685-5 ATM Kinase Inhibitor, KU-55933 Biovision 5 mg 211€ Pub
1685-5 ATM Kinase Inhibitor, KU-55933; Appearance White solid Biovision 5 mg 219.24 1685-5 ATM Kinase Inhibitor, KU-55933; Appearance White solid Biovision 5 mg 219.24€ Pub
1974-25 ML130 Biovision 25 mg 382 1974-25 ML130 Biovision 25 mg 382€
ASK
Pub
1974-25 ML130; Appearance White solid Biovision 25 mg 400.68 1974-25 ML130; Appearance White solid Biovision 25 mg 400.68€
ASK
Pub
1974-5 ML130 Biovision 5 mg 133 1974-5 ML130 Biovision 5 mg 133€
ASK
Pub
1974-5 ML130; Appearance White solid Biovision 5 mg 136.08 1974-5 ML130; Appearance White solid Biovision 5 mg 136.08€
ASK
Pub
20-273 Agar, Powdered Bacto-Style Bacteriological Grade Genesee 500g/Unit 99 20-273 Agar, Powdered Bacto-Style Bacteriological Grade Genesee 500g/Unit 99€
ASK
Pub
200100 pOET sequencing primers OET 2 x 100 176.841 200100 pOET sequencing primers OET 2 x 100 176.841€
ASK
Pub
21-126 Culture Tubes, 12x75, PP Polypropylene, Sterile Genesee 8 Bags of 125 Tubes/Unit 178 21-126 Culture Tubes, 12x75, PP Polypropylene, Sterile Genesee 8 Bags of 125 Tubes/Unit 178€
ASK
Pub
21-235 3ml Test Tubes, 12x55mm Genesee 99 21-235 3ml Test Tubes, 12x55mm Genesee 99€
ASK
Pub
21-255 Screw Cap Tubes & O-Ring Caps Tubes 2.0ml ScrewCap Tubes,Sterile Not Self-Standing, Caps On Genesee 5 Bags of 100 Tubes/Unit 116 21-255 Screw Cap Tubes & O-Ring Caps Tubes 2.0ml ScrewCap Tubes,Sterile Not Self-Standing, Caps On Genesee 5 Bags of 100 Tubes/Unit 116€
ASK
Pub
21081 Quest Fluo 8™, AM AAT Bioquest 5x50 ug 130 21081 Quest Fluo 8™, AM AAT Bioquest 5x50 ug 130€
ASK
Pub
21117 Chk2 (Ab-516) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21117 Chk2 (Ab-516) Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21121 Quest Rhod 4™, AM AAT Bioquest 5x50 ug 202 21121 Quest Rhod 4™, AM AAT Bioquest 5x50 ug 202€
ASK
Pub
21128 Quest Rhod 4™, sodium salt AAT Bioquest 5x50 ug 280 21128 Quest Rhod 4™, sodium salt AAT Bioquest 5x50 ug 280€
ASK
Pub
21142 Cal-520FF™, AM AAT Bioquest 1 mg 436 21142 Cal-520FF™, AM AAT Bioquest 1 mg 436€
ASK
Pub
21143 Cal-520FF™, AM AAT Bioquest 10x50 ug 319 21143 Cal-520FF™, AM AAT Bioquest 10x50 ug 319€
ASK
Pub
21144 Cal-520FF™, potassium salt AAT Bioquest 10x50 ug 319 21144 Cal-520FF™, potassium salt AAT Bioquest 10x50 ug 319€
ASK
Pub
21167 Lck(Ab-394) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195 21167 Lck(Ab-394) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21171 FKHRL1(Ab-253) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21171 FKHRL1(Ab-253) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21208 FAK (Ab-397) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 195 21208 FAK (Ab-397) Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21294 Tyrosine Hydroxylase (Ab-31) Antibody Source Rabbit Polyconal Ab Species Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21294 Tyrosine Hydroxylase (Ab-31) Antibody Source Rabbit Polyconal Ab Species Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21328 TrkB (Ab-705) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21328 TrkB (Ab-705) Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21330 α-catenin (Ab-641) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195 21330 α-catenin (Ab-641) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21334 SLK1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21334 SLK1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21423 Nanog Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195 21423 Nanog Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21426 Lin28 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21426 Lin28 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21428 MEK1 2 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21428 MEK1 2 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21430 ASPSCR1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21430 ASPSCR1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21431 TFE3 Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195 21431 TFE3 Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21432 EWS Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21432 EWS Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21433 FLI1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21433 FLI1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21436 MDM2 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21436 MDM2 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21437 CDK4 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21437 CDK4 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21438 SYT Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21438 SYT Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21440 MCL1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21440 MCL1 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21441 MAP2K4 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21441 MAP2K4 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21445 GABA A Receptor a 3 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21445 GABA A Receptor a 3 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21449 GRASP Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21449 GRASP Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21451 Periostin Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21451 Periostin Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21452 synaptophysin 2 Antibody Source Rabbit Polyconal Ab Species Rat Application WB SignalWay Antibody S.A.B 50ul 195 21452 synaptophysin 2 Antibody Source Rabbit Polyconal Ab Species Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21456 PKM1 2 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21456 PKM1 2 Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21457 PRLR Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21457 PRLR Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21459 FBXL3 Antibody Source Rabbit Polyconal Ab Species Mouse Application WB SignalWay Antibody S.A.B 50ul 195 21459 FBXL3 Antibody Source Rabbit Polyconal Ab Species Mouse Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21466 Eif1 Antibody Source Rabbit Polyconal Ab Species Drosophila Application WB SignalWay Antibody S.A.B 50ul 195 21466 Eif1 Antibody Source Rabbit Polyconal Ab Species Drosophila Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21468 CD56(NCAM) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195 21468 CD56(NCAM) Antibody Source Rabbit Polyconal Ab Species Human Mouse Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21469 CD34 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195 21469 CD34 Antibody Source Rabbit Polyconal Ab Species Human Mouse Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21471 CD44 Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 195 21471 CD44 Antibody Source Rabbit Polyconal Ab Species Human Rat Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21475 REST Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195 21475 REST Antibody Source Rabbit Polyconal Ab Species Human Application WB SignalWay Antibody S.A.B 50ul 195€
ASK
Pub
21476 CD Marker ABCG2(CD338) Antibody SignalWay Antibody S.A.B 50ul 236 21476 CD Marker ABCG2(CD338) Antibody SignalWay Antibody S.A.B 50ul 236€
ASK
Pub
  Cat_Number Product name Supplier Quantity Price PDF Pub