Product name :AccuPower DNA Sequencing Kit 0.2 ml thin wall 8 strip tubes

Catalog Number :K-1010-1

Quantity :24 reactions

Price :203 Eur

Pay now with :

Supplier :Bioneer


AccuPower® DNA Sequencing Kit is a premix-type product, which contains all reagents for DNA sequencing lyophilized in one tube so the DNA sequence can be analyzed rapidly and accurately. Because sequencing reaction is run at high temperatures during thermal cycling, alkaline denaturation of double-stranded DNA is not necessary and problems from the template DNA secondary structure and high GC content can be minimized. The product also contains 7-deaza dGTP, minimizing band compression. The best sequencing results can be obtained since band intensity background is minimized by using sequencing grade Top™ DNA polymerase, of which 5’->3’ exonuclease activity is deactivated by cloning DNA polymerase gene of Thermus thermophilus into E.coli and manipulating the gene.


Sensitivity & reproducibility

All components necessary for a successful reaction have been dispensed in single-reaction portions for convenience, and the patented AccuPower® technology provides unrivaled reagent stability and result reproducibility.


All components are premixed and lyophilized in each G/A/T/C tube
G mix : ddGTPs/dNTPs
A mix : ddATPs/dNTPs
T mix : ddTTPs/dNTPs
C mix : ddCTPs/dNTPs
Each mix contains buffer and Top™ DNA polymerase.

* A specific dye which doesn’t affect the sequencing reaction is included to enable checking of the mixing process and monitoring the loss of reaction solution.

* Reducing repetitive and tedious pipetting and mixing minimizes experimental errors.
Storage : Store at -20°C


figure1

Fig. 1. The sequence analysis of plasmid DNA

DNA sequence analysis of purified plasmid DNA 1 μg of the purified sample was sequenced using AccuPower® DNA Sequencing Kit(K-1010) and stained by Silverstar® Staining Kit (K-1050)



References1. Template DNA & primer

   PCR product(200 bp) 100~300 ng
   Primer(17-24mer) 20~30 pmoles
   Plasmid DNA(3,000 bp) 1~2 μg
   Primer(17-24mer) 20~30 pmoles



References2. Primer Sequences

 M13/pUC(-47) Forward Primer 24mer
 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'
 M13/pUC(-48) Reverse Primer 24mer
 5'-d(AGCGGATAACAATTTCACAGGA)-3'

figure1

Ask Technical File!

Question about this product?

Name

Email Address

Message

Retype code:

random val Reload Image


[Related Products]AccuPower DNA Sequencing Kit 0.2 ml thin wall 8 strip tubes

Filter: (Type enter to validate)
  Cat_Number Product name Supplier Quantity Price Tech More
K-1010-1 AccuPower DNA Sequencing Kit 0.2 ml thin wall 8 strip tubes Bioneer 24 reactions 203 K-1010-1 AccuPower DNA Sequencing Kit 0.2 ml thin wall 8 strip tubes Bioneer 24 reactions 203€
ASK
Pub
K-1020 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 100 reactions 307 K-1020 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 100 reactions 307€
ASK
Pub
K-1020-1 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 500 reactions 1074 K-1020-1 TopTM DNA Sequencing Kit Solution Type 0.2 ml thin wall 8 strip tubes Bioneer 500 reactions 1074€
ASK
Pub
K-1010 AccuPower DNA Sequencing Kit 0.5 ml tubes Bioneer 25 reactions 203 K-1010 AccuPower DNA Sequencing Kit 0.5 ml tubes Bioneer 25 reactions 203€
ASK
Pub
K-2012 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 76 K-2012 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 76€ Pub
K-2012-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 176 K-2012-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 176€ Pub
K-2016 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 300 K-2016 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 300€ Pub
K-2016-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 488 K-2016-1 AccuPower PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 488€ Pub
K-2111 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 114 K-2111 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 114€ Pub
K-2113 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 228 K-2113 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 228€ Pub
K-2611 AccuPower PyroHotStart Taq PCR PreMix NEW 0.2 ml thin-wall 8-strip tubes with attached cap 96 tubes Bioneer 20 ul 174 K-2611 AccuPower PyroHotStart Taq PCR PreMix NEW 0.2 ml thin-wall 8-strip tubes with attached cap 96 tubes Bioneer 20 ul 174€
ASK
Pub
K-5050 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 90 K-5050 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 90€ Pub
K-5050-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 144 K-5050-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 20 ul 144€ Pub
K-5051 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 370 K-5051 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 370€ Pub
K-5051-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 481 K-5051-1 AccuPower HotStart PCR PreMix (with UDG) NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 20 ul 481€ Pub
K-2013 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 150 K-2013 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 150€ Pub
K-2017 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 498 K-2017 AccuPower PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 498€ Pub
K-2043 AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 721 K-2043 AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 721€ Pub
K-2043-B AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 1340 K-2043-B AccuPower RT PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 1340€ Pub
K-2112 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 456 K-2112 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 456€ Pub
K-2114 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 913 K-2114 AccuPower Multiplex PCR PreMix NEW 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 913€ Pub
K-5052 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 215 K-5052 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 96 tubes Bioneer 50 ul 215€ Pub
K-5057 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 741 K-5057 AccuPower HotStart PCR PreMix 0.2 ml thin wall 8 strip tubes with attached cap 480 tubes Bioneer 50 ul 741€ Pub
K-2042 AccuPower RT PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 259 K-2042 AccuPower RT PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 259€ Pub
K-5053 AccuPower HotStart PCR PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 214 K-5053 AccuPower HotStart PCR PreMix 0.5 ml thin wall tubes with attached cap 100 tubes Bioneer 50 ul 214€ Pub
10-174 0.2ml Thin Wall PCR Tubes Genesee 117 10-174 0.2ml Thin Wall PCR Tubes Genesee 117€
ASK
Pub
22-161Y 8 well PCR Tubes, Yellow Ultra Thin Wall Genesee Box Of 125 Strips/Unit 170 22-161Y 8 well PCR Tubes, Yellow Ultra Thin Wall Genesee Box Of 125 Strips/Unit 170€
ASK
Pub
3426.12.X 0.2 ml Strip tubes & caps 80 strips pk 10 pks cs Biotix 769 3426.12.X 0.2 ml Strip tubes & caps 80 strips pk 10 pks cs Biotix 769€
ASK
Pub
K-2080-3 AccuPower PCR PreMix thin wall 384 well full skirted plate Bioneer 20 ul 453 K-2080-3 AccuPower PCR PreMix thin wall 384 well full skirted plate Bioneer 20 ul 453€ Pub
K-2084-3 AccuPower RT PCR PreMix thin wall 384 well full skirted plate Bioneer 20 ul 1520 K-2084-3 AccuPower RT PCR PreMix thin wall 384 well full skirted plate Bioneer 20 ul 1520€ Pub
K-2260-4 AccuPower PCR PreMix thin wall 96 well flat plate Bioneer 20 ul 84 K-2260-4 AccuPower PCR PreMix thin wall 96 well flat plate Bioneer 20 ul 84€ Pub
K-2260-5 AccuPower PCR PreMix thin wall 96 well full skirted plate Bioneer 20 ul 84 K-2260-5 AccuPower PCR PreMix thin wall 96 well full skirted plate Bioneer 20 ul 84€ Pub
K-2260-6 AccuPower PCR PreMix thin wall 96 well semi skirted plate Bioneer 20 ul 84 K-2260-6 AccuPower PCR PreMix thin wall 96 well semi skirted plate Bioneer 20 ul 84€ Pub
K-2262-4 AccuPower RT PCR PreMix thin wall 96 well flat plate Bioneer 20 ul 276 K-2262-4 AccuPower RT PCR PreMix thin wall 96 well flat plate Bioneer 20 ul 276€ Pub
K-2262-5 AccuPower RT PCR PreMix thin wall 96 well full skirted plate Bioneer 20 ul 276 K-2262-5 AccuPower RT PCR PreMix thin wall 96 well full skirted plate Bioneer 20 ul 276€ Pub
K-2262-6 AccuPower RT PCR PreMix thin wall 96 well semi skirted plate Bioneer 20 ul 276 K-2262-6 AccuPower RT PCR PreMix thin wall 96 well semi skirted plate Bioneer 20 ul 276€ Pub
PPO-200 ProPrep™ Omni 200 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group Up to 200 ml cultures 460 PPO-200 ProPrep™ Omni 200 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group Up to 200 ml cultures 460€ Pub
HWI-3 Hematoxylin, Weigert's Iron Kit Scy tek 2000 ml 175 HWI-3 Hematoxylin, Weigert's Iron Kit Scy tek 2000 ml 175€
ASK
Pub
02-050 T4 DNA Ligase, standard kit B-Bridge 20000 U 103.688 02-050 T4 DNA Ligase, standard kit B-Bridge 20000 U 103.688€
ASK
Pub
02-050 T4 DNA Ligase, standard kit T4 DNA Ligase, standard kit B-Bridge 20000 U 50.4 02-050 T4 DNA Ligase, standard kit T4 DNA Ligase, standard kit B-Bridge 20000 U 50.4€
ASK
Pub
27-125 .2ml 8-Well PCR Strip Tubes Genesee 156 27-125 .2ml 8-Well PCR Strip Tubes Genesee 156€
ASK
Pub
3426.8.X 0.2 ml Strip tubes & caps 125 strips pack 10 pks case Biotix 505 3426.8.X 0.2 ml Strip tubes & caps 125 strips pack 10 pks case Biotix 505€
ASK
Pub
3428.8.X 0.2 ml Strip tubes & caps 8 ,120 strips pk 10 pks cs Biotix 895 3428.8.X 0.2 ml Strip tubes & caps 8 ,120 strips pk 10 pks cs Biotix 895€
ASK
Pub
BB24-AU-CE Homogenizer for 24 samples in microcentrifuge tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Up Next Advence 4850 BB24-AU-CE Homogenizer for 24 samples in microcentrifuge tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Up Next Advence 4850€ Pub
BBX24-CE Homogenizer for 24 samples in microcentrifuge tubes. Includes starter kit of beads, scoops and tubes. Upgraded electronics and CE certification. Next Advence 2684 BBX24-CE Homogenizer for 24 samples in microcentrifuge tubes. Includes starter kit of beads, scoops and tubes. Upgraded electronics and CE certification. Next Advence 2684€ Pub
BBY24M-CE Homogenizer for 24 samples in microcentrifuge tubes. More powerful motor for tough samples. Includes starter kit of beads, scoops and tubes. Air Cooling to prevent heat loading during homogenizatio Next Advence 3594 BBY24M-CE Homogenizer for 24 samples in microcentrifuge tubes. More powerful motor for tough samples. Includes starter kit of beads, scoops and tubes. Air Cooling to prevent heat loading during homogenizatio Next Advence 3594€ Pub
D-1040-1 AccuLadder 1 kb DNA Size Marker 500 10,200 bp Bioneer 500 ul x 2 tubes (65 ng/ul) 262 D-1040-1 AccuLadder 1 kb DNA Size Marker 500 10,200 bp Bioneer 500 ul x 2 tubes (65 ng/ul) 262€ Pub
ELH-2B4-001 Custom Human 2B4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-2B4-001 Custom Human 2B4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-IL21R-001 Custom Human IL-21 R Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-IL21R-001 Custom Human IL-21 R Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-IL28A-001 Human IL-28A ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-IL28A-001 Human IL-28A ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-IL29-001 Human IL-29 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-IL29-001 Human IL-29 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELM-IL28-001 Mouse IL-28 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELM-IL28-001 Mouse IL-28 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€
ASK
Pub
GM345 100 1000bp DNA Marker, Ready to Use BBI Biotech 13 DNA fragments: 50, 100X2, 150, 200X2 ,250, 300, 400, 500X2, 600, 700, 800, 900 and 1031bp 84 GM345 100 1000bp DNA Marker, Ready to Use BBI Biotech 13 DNA fragments: 50, 100X2, 150, 200X2 ,250, 300, 400, 500X2, 600, 700, 800, 900 and 1031bp 84€ Pub
H1212-35A Rotisserie for 12 of 300 x 35 mm diameter bottles, 24 of 150 x 35 mm diameter bottles or 24 of 50 ml tubes horizonal. Fits H5000 only Labnet International Inc. 343 H1212-35A Rotisserie for 12 of 300 x 35 mm diameter bottles, 24 of 150 x 35 mm diameter bottles or 24 of 50 ml tubes horizonal. Fits H5000 only Labnet International Inc. 343€
ASK
Pub
K-2080-1 AccuPower PCR PreMix thin wall 384 well full skirted plate Bioneer 5 ul 409 K-2080-1 AccuPower PCR PreMix thin wall 384 well full skirted plate Bioneer 5 ul 409€ Pub
K-2080-2 AccuPower PCR PreMix thin wall 384 well full skirted plate Bioneer 10 ul 431 K-2080-2 AccuPower PCR PreMix thin wall 384 well full skirted plate Bioneer 10 ul 431€ Pub
K-2084-1 AccuPower RT PCR PreMix thin wall 384 well full skirted plate Bioneer 5 ul 1372 K-2084-1 AccuPower RT PCR PreMix thin wall 384 well full skirted plate Bioneer 5 ul 1372€ Pub
K-2084-2 AccuPower RT PCR PreMix thin wall 384 well full skirted plate Bioneer 10 ul 1445 K-2084-2 AccuPower RT PCR PreMix thin wall 384 well full skirted plate Bioneer 10 ul 1445€ Pub
K-2260-1 AccuPower PCR PreMix thin wall 96 well flat plate Bioneer 10 ul 79 K-2260-1 AccuPower PCR PreMix thin wall 96 well flat plate Bioneer 10 ul 79€ Pub
K-2260-2 AccuPower PCR PreMix thin wall 96 well full skirted plate Bioneer 10 ul 79 K-2260-2 AccuPower PCR PreMix thin wall 96 well full skirted plate Bioneer 10 ul 79€ Pub
K-2260-3 AccuPower PCR PreMix thin wall 96 well semi skirted plate Bioneer 10 ul 79 K-2260-3 AccuPower PCR PreMix thin wall 96 well semi skirted plate Bioneer 10 ul 79€ Pub
K-2262-1 AccuPower RT PCR PreMix thin wall 96 well flat plate Bioneer 10 ul 262 K-2262-1 AccuPower RT PCR PreMix thin wall 96 well flat plate Bioneer 10 ul 262€ Pub
K-2262-2 AccuPower RT PCR PreMix thin wall 96 well full skirted plate Bioneer 10 ul 262 K-2262-2 AccuPower RT PCR PreMix thin wall 96 well full skirted plate Bioneer 10 ul 262€ Pub
K-2262-3 AccuPower RT PCR PreMix thin wall 96 well semi skirted plate Bioneer 10 ul 262 K-2262-3 AccuPower RT PCR PreMix thin wall 96 well semi skirted plate Bioneer 10 ul 262€ Pub
K-6100 AccuPower DualStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests , optical film included Bioneer 20 ul 128 K-6100 AccuPower DualStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests , optical film included Bioneer 20 ul 128€ Pub
K-6101 AccuPower DualStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests , optical film included Bioneer 20 ul 143 K-6101 AccuPower DualStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests , optical film included Bioneer 20 ul 143€ Pub
K-6102 AccuPower DualStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 20 ul 138 K-6102 AccuPower DualStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 20 ul 138€ Pub
K-6210 AccuPower GreenStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests, optical film included Bioneer 20 ul 128 K-6210 AccuPower GreenStar qPCR PreMix Exicycler 8 well strip, 12 strips 96 tests, optical film included Bioneer 20 ul 128€ Pub
K-6211 AccuPower GreenStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests, optical film included Bioneer 20 ul 143 K-6211 AccuPower GreenStar qPCR PreMix ABI 7500 8 well strip, 12 strips 96 tests, optical film included Bioneer 20 ul 143€ Pub
K-6212 AccuPower GreenStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 20 ul 138 K-6212 AccuPower GreenStar qPCR PreMix Opticon 8 well strip, 12 strips 96 tests Bioneer 20 ul 138€ Pub
K-6252 AccuPower GreenStar qPCR Master Mix NEW 5.0 ml 200 reactions Bioneer 50 ul 323 K-6252 AccuPower GreenStar qPCR Master Mix NEW 5.0 ml 200 reactions Bioneer 50 ul 323€ Pub
PP-207XS Plant DNA Preparation Kit, Sample Jena Bioscience 20preparations 50 PP-207XS Plant DNA Preparation Kit, Sample Jena Bioscience 20preparations 50€
ASK
Pub
SL100489-CaS Transfection Reagents and Kits, GenJet™ DNA In Vitro Tranfection Reagent for Ca Ski was pre optimized for most efficiently transfecting Ca Ski cells. Signagen 1 ml 231.368 SL100489-CaS Transfection Reagents and Kits, GenJet™ DNA In Vitro Tranfection Reagent for Ca Ski was pre optimized for most efficiently transfecting Ca Ski cells. Signagen 1 ml 231.368€ Pub
SSD-909-MC Rat Serum (Sprague Dawley) Heavy Charcoal Stripped LeeBio 25 ml 317 SSD-909-MC Rat Serum (Sprague Dawley) Heavy Charcoal Stripped LeeBio 25 ml 317€
ASK
Pub
Z7040006-1 EZ DNA 96 Kit Biochain 2x96 471.45 Z7040006-1 EZ DNA 96 Kit Biochain 2x96 471.45€ Pub
A00017 CD45, Leucocyte Common Antigen (LCA); Clones PD7 26 and 2B11 Scy tek 6 ml Ready-to-use 98 A00017 CD45, Leucocyte Common Antigen (LCA); Clones PD7 26 and 2B11 Scy tek 6 ml Ready-to-use 98€
ASK
Pub
A00017.0025 CD45, Leucocyte Common Antigen (LCA); Clones PD7 26 and 2B11 Scy tek 25 ml Ready-to-use 211 A00017.0025 CD45, Leucocyte Common Antigen (LCA); Clones PD7 26 and 2B11 Scy tek 25 ml Ready-to-use 211€
ASK
Pub
A00020 Neurofilaments; Clone 2F11 Scy tek 6 ml Ready-to-use 129 A00020 Neurofilaments; Clone 2F11 Scy tek 6 ml Ready-to-use 129€
ASK
Pub
A00020.0025 Neurofilaments; Clone 2F11 Scy tek 25 ml Ready-to-use 311 A00020.0025 Neurofilaments; Clone 2F11 Scy tek 25 ml Ready-to-use 311€
ASK
Pub
A20017 CD45, Leucocyte Common Antigen (LCA); Clones PD7 26 and 2B11 Scy tek 2 ml Ready-to-use 75 A20017 CD45, Leucocyte Common Antigen (LCA); Clones PD7 26 and 2B11 Scy tek 2 ml Ready-to-use 75€
ASK
Pub
A20020 Neurofilaments; Clone 2F11 Scy tek 2 ml Ready-to-use 90 A20020 Neurofilaments; Clone 2F11 Scy tek 2 ml Ready-to-use 90€
ASK
Pub
R6022 Casein ELISA Kit Milk caseins caseinate detection by ELISA (LOD <0.2ppm; range 0.8-16ppm SMP) Imutest 96 wells 407 R6022 Casein ELISA Kit Milk caseins caseinate detection by ELISA (LOD <0.2ppm; range 0.8-16ppm SMP) Imutest 96 wells 407€
ASK
Pub
000493A DNASE I ABM Goods 250ul 621 000493A DNASE I ABM Goods 250ul 621€
ASK
Pub
000669A PAK1 (dn 83 86 299) ABM Goods 250ul 621 000669A PAK1 (dn 83 86 299) ABM Goods 250ul 621€
ASK
Pub
000670A PAK1 (dn 83 86) ABM Goods 250ul 621 000670A PAK1 (dn 83 86) ABM Goods 250ul 621€
ASK
Pub
000782A mLin28 ABM Goods 250ul 1659 000782A mLin28 ABM Goods 250ul 1659€
ASK
Pub
000805A SIVgag251 (626 877 n.t.) ABM Goods 250ul 1184 000805A SIVgag251 (626 877 n.t.) ABM Goods 250ul 1184€
ASK
Pub
000806A SIVgag251 (842 1095 n.t.) ABM Goods 250ul 1184 000806A SIVgag251 (842 1095 n.t.) ABM Goods 250ul 1184€
ASK
Pub
000822A HIVCN54gag (753 831 n.t.) ABM Goods 250ul 1184 000822A HIVCN54gag (753 831 n.t.) ABM Goods 250ul 1184€
ASK
Pub
000823A HIVCN54gag (805 1026 n.t.) ABM Goods 250ul 1184 000823A HIVCN54gag (805 1026 n.t.) ABM Goods 250ul 1184€
ASK
Pub
0810051 BACTERIOLOGY BACTERIOPHAGE LAMBDA, DNA 25ug Zeptometrix 1 0 0810051 BACTERIOLOGY BACTERIOPHAGE LAMBDA, DNA 25ug Zeptometrix 1 0€
ASK
Pub
14-262 1.2ml Microtitertube Racked, Sterile Genesee 10 Racks of 96 Tubes/Unit 90 14-262 1.2ml Microtitertube Racked, Sterile Genesee 10 Racks of 96 Tubes/Unit 90€
ASK
Pub
1912-25 Ro 61-8048 Biovision 25 mg 396 1912-25 Ro 61-8048 Biovision 25 mg 396€ Pub
1974-25 ML130 Biovision 25 mg 382 1974-25 ML130 Biovision 25 mg 382€
ASK
Pub
1974-25 ML130; Appearance White solid Biovision 25 mg 400.68 1974-25 ML130; Appearance White solid Biovision 25 mg 400.68€
ASK
Pub
19791 Cellufine GCL-2000 Media AGTC Bioproducts Ltd 500 ml 372 19791 Cellufine GCL-2000 Media AGTC Bioproducts Ltd 500 ml 372€ Pub
19791 Cellufine GCL 2000 , 500 ml Chisso 500 ml 383.25 19791 Cellufine GCL 2000 , 500 ml Chisso 500 ml 383.25€ Pub
1L05S3 Cocaine test strip Boson 100 tests/kit 129 1L05S3 Cocaine test strip Boson 100 tests/kit 129€
ASK
Pub
1L12S3 Opiate-2000 test strip, Substance of abuse Bosbio 3000 tests 896 1L12S3 Opiate-2000 test strip, Substance of abuse Bosbio 3000 tests 896€ Pub
21-395 Screw Cap Tubes & O-Ring Caps Tubes 50ml Transport Tubes Polypropylene, Sterile Genesee 20 Bags of 25 Tubes/Unit 190 21-395 Screw Cap Tubes & O-Ring Caps Tubes 50ml Transport Tubes Polypropylene, Sterile Genesee 20 Bags of 25 Tubes/Unit 190€
ASK
Pub
21179 DNA PKcs (Ab 2609) Antibody Host Species Rabbit polyclonal SignalWay Antibody S.A.B 50 ug 143 21179 DNA PKcs (Ab 2609) Antibody Host Species Rabbit polyclonal SignalWay Antibody S.A.B 50 ug 143€
ASK
Pub
22-283LR 2.0ml Microtubes Maximum Recovery Genesee Box of 250 Tubes/Unit x20 243 22-283LR 2.0ml Microtubes Maximum Recovery Genesee Box of 250 Tubes/Unit x20 243€
ASK
Pub
228-10327-1 Recombinant E. coli HSP40 DnaJ Proteins Ray Biotech 20 147 228-10327-1 Recombinant E. coli HSP40 DnaJ Proteins Ray Biotech 20 147€ Pub
228-10328-2 Recombinant Human HSP40 DnaJ Proteins Ray Biotech 25 205 228-10328-2 Recombinant Human HSP40 DnaJ Proteins Ray Biotech 25 205€
ASK
Pub
228-10333-1 Recombinant E. coli HSP70 DnaK LCS Proteins Ray Biotech 20 147 228-10333-1 Recombinant E. coli HSP70 DnaK LCS Proteins Ray Biotech 20 147€
ASK
Pub
228-10334-1 Recombinant E. coli HSP70 DnaK SBD Proteins Ray Biotech 20 147 228-10334-1 Recombinant E. coli HSP70 DnaK SBD Proteins Ray Biotech 20 147€
ASK
Pub
228-10335-1 Recombinant E. coli HSP70 DnaK SBD Proteins Ray Biotech 20 147 228-10335-1 Recombinant E. coli HSP70 DnaK SBD Proteins Ray Biotech 20 147€
ASK
Pub
228-10336-1 Native Bacterial DNase Proteins Ray Biotech 20mg 147 228-10336-1 Native Bacterial DNase Proteins Ray Biotech 20mg 147€
ASK
Pub
2311177 AE 8135 myPower II 300, 230V Atto 702 2311177 AE 8135 myPower II 300, 230V Atto 702€ Pub
232961 Tubes 30 ml PPCO AOR without screw cap Herolab 10 104.412 232961 Tubes 30 ml PPCO AOR without screw cap Herolab 10 104.412€
ASK
Pub
252700 Tubes 16 ml PC RB FL Herolab 10 90 252700 Tubes 16 ml PC RB FL Herolab 10 90€
ASK
Pub
27-104 8-Well PCR Strip Tubes Genesee 164 27-104 8-Well PCR Strip Tubes Genesee 164€
ASK
Pub
3102.X Cryo tubes & Vials 2.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 393 3102.X Cryo tubes & Vials 2.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 393€
ASK
Pub
3103.X Cryo tubes & Vials 3.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 398 3103.X Cryo tubes & Vials 3.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 398€
ASK
Pub
3104.X Cryo tubes & Vials 4.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 452 3104.X Cryo tubes & Vials 4.0 ml Cryovial with Locking Base Biotix 100 per bag, 10 bags per case 452€
ASK
Pub
3423.X 0.2 ml PCR Tube Flat cap, 1000 tubes pack 10 packs case Biotix 333 3423.X 0.2 ml PCR Tube Flat cap, 1000 tubes pack 10 packs case Biotix 333€
ASK
Pub
3425.X 0.2 ml PCR Tube Dome cap 10 bags of 100 tubes pack 10 packs per case Biotix 333 3425.X 0.2 ml PCR Tube Dome cap 10 bags of 100 tubes pack 10 packs per case Biotix 333€
ASK
Pub
3590BP-50 KiSS-1 Blocking Peptide;Appearance Colorless liquid; Accession NP 839991;Gene ID 280287 Biovision 50 ug 145.53 3590BP-50 KiSS-1 Blocking Peptide;Appearance Colorless liquid; Accession NP 839991;Gene ID 280287 Biovision 50 ug 145.53€
ASK
Pub
3737.X 0.6 ml PCR tubes 1000 per bag, 10 bags per case Biotix 291 3737.X 0.6 ml PCR tubes 1000 per bag, 10 bags per case Biotix 291€
ASK
Pub
3763.S.X Screw cap Tubes TUBE2.0ML FLATBASE CS2500 Sterile Biotix 250 tubes/pk 10 pks/cs 336 3763.S.X Screw cap Tubes TUBE2.0ML FLATBASE CS2500 Sterile Biotix 250 tubes/pk 10 pks/cs 336€
ASK
Pub
3765.X 2.0 ml MCT Tube 500 tubes pk 10 pks case Biotix 144 3765.X 2.0 ml MCT Tube 500 tubes pk 10 pks case Biotix 144€
ASK
Pub
4014 NUTRIENT AGAR Media for General Use Condalab Box of 20 tubes x 10 170 4014 NUTRIENT AGAR Media for General Use Condalab Box of 20 tubes x 10 170€
ASK
Pub
4201 PEPTONE WATER Condalab -BULK Box of 20 tubes 50 4201 PEPTONE WATER Condalab -BULK Box of 20 tubes 50€
ASK
Pub
4203 MANNITOL SALT AGAR (CHAPMAN) Condalab -BULK Box of 20 tubes 50 4203 MANNITOL SALT AGAR (CHAPMAN) Condalab -BULK Box of 20 tubes 50€
ASK
Pub
4445.X 1.6 ml MCT Tube 1.6ml MCT SC GRAD NAT Biotix 500 tubes/pk 10 pks/case 185 4445.X 1.6 ml MCT Tube 1.6ml MCT SC GRAD NAT Biotix 500 tubes/pk 10 pks/case 185€
ASK
Pub
4676-096-K Universal Chemiluminescent PARP Assay Kit w Histone Coated Strip wells Trevigen 96 Samples 484 4676-096-K Universal Chemiluminescent PARP Assay Kit w Histone Coated Strip wells Trevigen 96 Samples 484€ Pub
4677-096-K Universal Colorimetric PARP Assay Kit w Histone Coated Strip Wells Trevigen 96 Samples 484 4677-096-K Universal Colorimetric PARP Assay Kit w Histone Coated Strip Wells Trevigen 96 Samples 484€ Pub
4890-25-K MTT Cell Proliferation Assay Kit Trevigen 2500 Tests 274 4890-25-K MTT Cell Proliferation Assay Kit Trevigen 2500 Tests 274€ Pub
672000327 Cellufine GCL-2000 Media AGTC Bioproducts Ltd 100 ml 216 672000327 Cellufine GCL-2000 Media AGTC Bioproducts Ltd 100 ml 216€ Pub
672000327 Cellufine GCL 2000 , 100 ml Chisso 100 ml 213.15 672000327 Cellufine GCL 2000 , 100 ml Chisso 100 ml 213.15€ Pub
9001-2500 Taq DNA Polymerase Biovision 2500 u 405.5 9001-2500 Taq DNA Polymerase Biovision 2500 u 405.5€ Pub
9003-2500 PFU DNA Polymerase Biovision 2500 u 405.5 9003-2500 PFU DNA Polymerase Biovision 2500 u 405.5€ Pub
A-1008 AZD-8055 Mechanisms: mTORC1 C2 inhibitor ActivBio 20mg 311 A-1008 AZD-8055 Mechanisms: mTORC1 C2 inhibitor ActivBio 20mg 311€ Pub
A-1192 MLN-2480 Mechanisms: Raf inhibitor ActivBio 5mg 311 A-1192 MLN-2480 Mechanisms: Raf inhibitor ActivBio 5mg 311€
ASK
Pub
A-2060-A1 AccuPower Calibration Kit for ExicyclerTM 96 Bioneer 1 1696 A-2060-A1 AccuPower Calibration Kit for ExicyclerTM 96 Bioneer 1 1696€ Pub
A104500 AB-005 C23H32N2O CAS: 895155-25-6 TRC 5 mg 342 A104500 AB-005 C23H32N2O CAS: 895155-25-6 TRC 5 mg 342€
ASK
Pub
A162660 3-Aceto-2-hydroxybiphenyl C14H12O2 CAS: 21424-82-8 TRC 1 g 245 A162660 3-Aceto-2-hydroxybiphenyl C14H12O2 CAS: 21424-82-8 TRC 1 g 245€
ASK
Pub
A164092 Acetovanillone-d3 C9H7D3O3 CAS: 80404-23-5 TRC 10 mg 245 A164092 Acetovanillone-d3 C9H7D3O3 CAS: 80404-23-5 TRC 10 mg 245€
ASK
Pub
A165380 3-Acetoxy-2,2-dimethylbutyryl Chloride C8H13ClO3 CAS: 859082-28-3 TRC 25 mg 206 A165380 3-Acetoxy-2,2-dimethylbutyryl Chloride C8H13ClO3 CAS: 859082-28-3 TRC 25 mg 206€
ASK
Pub
A165620 2-(4’-Acetoxy-2-fluoro-biphenyl-4-yl)-propionic Acid Methyl Ester C18H17FO4 CAS: 215175-84-1 TRC 10 mg 180 A165620 2-(4’-Acetoxy-2-fluoro-biphenyl-4-yl)-propionic Acid Methyl Ester C18H17FO4 CAS: 215175-84-1 TRC 10 mg 180€
ASK
Pub
A166490 2-(4-Acetoxy-2-methoxyphenoxy)-acetonitrile C11H11NO4 CAS: 887352-07-0 TRC 250 mg 193 A166490 2-(4-Acetoxy-2-methoxyphenoxy)-acetonitrile C11H11NO4 CAS: 887352-07-0 TRC 250 mg 193€
ASK
Pub
A166750 5-Acetoxymethyl-N-acetyl-2-pyrrolidinone C9H13NO4 CAS: 887352-10-5� TRC 250 mg 232 A166750 5-Acetoxymethyl-N-acetyl-2-pyrrolidinone C9H13NO4 CAS: 887352-10-5� TRC 250 mg 232€
ASK
Pub
A168240 4-(Acetylamino)-2-ethoxy-5-nitrobenzoic Acid Methyl Ester C12H14NO2O6 CAS: 86718-16-3 TRC 250 mg 245 A168240 4-(Acetylamino)-2-ethoxy-5-nitrobenzoic Acid Methyl Ester C12H14NO2O6 CAS: 86718-16-3 TRC 250 mg 245€
ASK
Pub
A168260 (R)-N-Acetyl-6-(4-aminophenyl)-4,5-dihydro-5-methyl-3(2H)-pyridazinone C13H15N3O2 CAS: 220246-81-1 TRC 5 mg 232 A168260 (R)-N-Acetyl-6-(4-aminophenyl)-4,5-dihydro-5-methyl-3(2H)-pyridazinone C13H15N3O2 CAS: 220246-81-1 TRC 5 mg 232€
ASK
Pub
A168355 N-Acetyl-L-arginine Amide Hydrochloride C8H18ClN5O2 CAS: 88530-28-3 TRC 100 mg 212 A168355 N-Acetyl-L-arginine Amide Hydrochloride C8H18ClN5O2 CAS: 88530-28-3 TRC 100 mg 212€
ASK
Pub
A168935 2-Amino-4,5,6,7,8-pentahydrothiazolo[5,4-d]azepine C7H11N3S CAS: 86029-68-7 TRC 25 mg 277 A168935 2-Amino-4,5,6,7,8-pentahydrothiazolo[5,4-d]azepine C7H11N3S CAS: 86029-68-7 TRC 25 mg 277€
ASK
Pub
A173560 2-N-Acetyl-1’,2’-di-O-acetyl-6-biopterin C15H17N5O6 CAS: 81827-31-8 TRC 25 mg 193 A173560 2-N-Acetyl-1’,2’-di-O-acetyl-6-biopterin C15H17N5O6 CAS: 81827-31-8 TRC 25 mg 193€
ASK
Pub
A173860 (1S,2R)-(+)-N-Acetyl Ephedrine C12H17NO2 CAS: 2272-83-5 TRC 5 mg 245 A173860 (1S,2R)-(+)-N-Acetyl Ephedrine C12H17NO2 CAS: 2272-83-5 TRC 5 mg 245€
ASK
Pub
A175825 2-(4’-Acetyl-2-fluoro-biphenyl-4-yl)-propionic Acid Methyl Ester C18H17FO3 CAS: 215175-83-0 TRC 25 mg 212 A175825 2-(4’-Acetyl-2-fluoro-biphenyl-4-yl)-propionic Acid Methyl Ester C18H17FO3 CAS: 215175-83-0 TRC 25 mg 212€
ASK
Pub
A178300 O-Acetyl-L-homoserine Hydrochloride, 95% C6H12ClNO4 CAS: 250736-84-6 TRC 10 mg 193 A178300 O-Acetyl-L-homoserine Hydrochloride, 95% C6H12ClNO4 CAS: 250736-84-6 TRC 10 mg 193€
ASK
Pub
A179480 N-Acetyl-L-isoglutamine C7H12N2O4 CAS: 25460-87-1 TRC 100 mg 232 A179480 N-Acetyl-L-isoglutamine C7H12N2O4 CAS: 25460-87-1 TRC 100 mg 232€
ASK
Pub
A186560 4-(Acetylmethylamino)-1-(3-pyridyl)-1-butanol C12H18N2O2 CAS: 887352-16-1 TRC 25 mg 232 A186560 4-(Acetylmethylamino)-1-(3-pyridyl)-1-butanol C12H18N2O2 CAS: 887352-16-1 TRC 25 mg 232€
ASK
Pub
A186610 1-Acetyl-4-(p-methylbenzoyl)piperidine C15H19NO2 CAS: 887352-19-4 TRC 250 mg 212 A186610 1-Acetyl-4-(p-methylbenzoyl)piperidine C15H19NO2 CAS: 887352-19-4 TRC 250 mg 212€
ASK
Pub
A187615 N-Acetyl-(+)-Pseudoephedrine C12H17NO2 CAS: 84472-25-3 TRC 10 mg 245 A187615 N-Acetyl-(+)-Pseudoephedrine C12H17NO2 CAS: 84472-25-3 TRC 10 mg 245€
ASK
Pub
A187650 2-Acetyl-1-pyrroline, 10% w w in DCM C6H9NO CAS: 85213-22-5 TRC 10 mg 245 A187650 2-Acetyl-1-pyrroline, 10% w w in DCM C6H9NO CAS: 85213-22-5 TRC 10 mg 245€
ASK
Pub
A188520 1-Acetyl-2,2,5,5-tetramethyl-3-pyrroline-3-carboxamide C11H18N2O2 CAS: 887352-22-9 TRC 50 mg 193 A188520 1-Acetyl-2,2,5,5-tetramethyl-3-pyrroline-3-carboxamide C11H18N2O2 CAS: 887352-22-9 TRC 50 mg 193€
ASK
Pub
A188530 1-Acetyl-2,2,5,5-tetramethyl-3-pyrroline-3-carboxylic Acid C11H17NO3 CAS: 887352-25-2 TRC 25 mg 193 A188530 1-Acetyl-2,2,5,5-tetramethyl-3-pyrroline-3-carboxylic Acid C11H17NO3 CAS: 887352-25-2 TRC 25 mg 193€
ASK
Pub
A188760 N-[2-[(Acetylthio)methyl]-1-oxo-3-phenylpropyl]glycine Methyl Ester C15H19NO4S CAS: 81110-05-6 TRC 25 mg 193 A188760 N-[2-[(Acetylthio)methyl]-1-oxo-3-phenylpropyl]glycine Methyl Ester C15H19NO4S CAS: 81110-05-6 TRC 25 mg 193€
ASK
Pub
A435000 AHR 11652 C15H8BrNO3� CAS: 241825-88-7� TRC 10 mg 277 A435000 AHR 11652 C15H8BrNO3� CAS: 241825-88-7� TRC 10 mg 277€
ASK
Pub
A511000 N-L-Alanyl-L-glutamic Acid Bis(benzyl) Ester C22H26N2O5 CAS: 87063-91-0 TRC 250 mg 277 A511000 N-L-Alanyl-L-glutamic Acid Bis(benzyl) Ester C22H26N2O5 CAS: 87063-91-0 TRC 250 mg 277€
ASK
Pub
A514600 Aldehydo-D-glucose Phthalazin-1-ylhydrazone C14H18N4O5 CAS: 881180-23-0� TRC 10 mg 232 A514600 Aldehydo-D-glucose Phthalazin-1-ylhydrazone C14H18N4O5 CAS: 881180-23-0� TRC 10 mg 232€
ASK
Pub
A535930 Alibendol C13H17NO4 CAS: 26750-81-2 TRC 100 mg 193 A535930 Alibendol C13H17NO4 CAS: 26750-81-2 TRC 100 mg 193€
ASK
Pub
A546125 D-Allocystathionine C7H14N2O4S CAS: 2998-83-6 TRC 100 mg 206 A546125 D-Allocystathionine C7H14N2O4S CAS: 2998-83-6 TRC 100 mg 206€
ASK
Pub
A576810 Amifostine C5H15N2O3PS CAS: 20537-88-6 TRC 10 mg 212 A576810 Amifostine C5H15N2O3PS CAS: 20537-88-6 TRC 10 mg 212€
ASK
Pub
A578700 Amiloride Hydrochloride C6H9Cl2N7O CAS: 2016-88-8 TRC 1 g 193 A578700 Amiloride Hydrochloride C6H9Cl2N7O CAS: 2016-88-8 TRC 1 g 193€
ASK
Pub
A593750 7-Amino-2(3H)-benzoxazolone C7H6N2O2 CAS: 81282-60-2 TRC 25 mg 212 A593750 7-Amino-2(3H)-benzoxazolone C7H6N2O2 CAS: 81282-60-2 TRC 25 mg 212€
ASK
Pub
A593840 2-Amino-3-(4-bromobenzoyl)benzoic Acid C14H10BrNO3 CAS: 241496-82-2 TRC 5 mg 245 A593840 2-Amino-3-(4-bromobenzoyl)benzoic Acid C14H10BrNO3 CAS: 241496-82-2 TRC 5 mg 245€
ASK
Pub
A593875 7-Amino-5-chloro-2(3H)-benzoxazolone C7H5ClN2O2 CAS: 889884-60-0 TRC 200 mg 212 A593875 7-Amino-5-chloro-2(3H)-benzoxazolone C7H5ClN2O2 CAS: 889884-60-0 TRC 200 mg 212€
ASK
Pub
A602000 N-(4-Aminobutyl)-5-chloro-2-naphthalenesulfonamide Hydrochloride C14H18Cl2N2O2S CAS: 88519-57-7 TRC 25 mg 193 A602000 N-(4-Aminobutyl)-5-chloro-2-naphthalenesulfonamide Hydrochloride C14H18Cl2N2O2S CAS: 88519-57-7 TRC 25 mg 193€
ASK
Pub
A603000 N-(4-Aminobutyl)-2-naphthalenesulfonamide Hydrochloride C14H19ClN2O2S CAS: 89108-46-3 TRC 25 mg 193 A603000 N-(4-Aminobutyl)-2-naphthalenesulfonamide Hydrochloride C14H19ClN2O2S CAS: 89108-46-3 TRC 25 mg 193€
ASK
Pub
A603004 4-Amino-1-tert-butyl-3-(1’-naphthyl)pyrazolo[3,4-d]pyrimidine C19H19N5 CAS: 221243-82-9 TRC 10 mg 232 A603004 4-Amino-1-tert-butyl-3-(1’-naphthyl)pyrazolo[3,4-d]pyrimidine C19H19N5 CAS: 221243-82-9 TRC 10 mg 232€
ASK
Pub
A603085 1-[4-Amino-7-(3-tert-butyldimethylsilyloxypropyl)-5-(4-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidine C22H32N4OSi CAS: 821794-84-7 TRC 25 mg 245 A603085 1-[4-Amino-7-(3-tert-butyldimethylsilyloxypropyl)-5-(4-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidine C22H32N4OSi CAS: 821794-84-7 TRC 25 mg 245€
ASK
Pub
A603090 4-Amino-5-carboxy-2-ethylmercaptopyrimidine C7H9N3O2S CAS: 89853-87-2 TRC 250 mg 232 A603090 4-Amino-5-carboxy-2-ethylmercaptopyrimidine C7H9N3O2S CAS: 89853-87-2 TRC 250 mg 232€
ASK
Pub
A603325 2-Amino-5-chloro-2',6'-difluoro-benzophenone C13H8ClF2NO CAS: 28910-83-0 TRC 100 mg 206 A603325 2-Amino-5-chloro-2',6'-difluoro-benzophenone C13H8ClF2NO CAS: 28910-83-0 TRC 100 mg 206€
ASK
Pub
A603439 4-Amino-2-chloro-6,7-dimethoxyquinazoline C10H10ClN3O2 CAS: 23680-84-4 TRC 10 g 193 A603439 4-Amino-2-chloro-6,7-dimethoxyquinazoline C10H10ClN3O2 CAS: 23680-84-4 TRC 10 g 193€
ASK
Pub
A603530 6-Amino-5-[(cyclopentanecarbonyl)amino]-1,3-dimethyl Uracil C12H18N4O3 CAS: 887352-43-4 TRC 200 mg 193 A603530 6-Amino-5-[(cyclopentanecarbonyl)amino]-1,3-dimethyl Uracil C12H18N4O3 CAS: 887352-43-4 TRC 200 mg 193€
ASK
Pub
A603740 β-Amino-α-oxo-cyclobutanebutanamide Hydrochloride C8H15ClN2O2 CAS: 817169-86-1 TRC 250 mg 206 A603740 β-Amino-α-oxo-cyclobutanebutanamide Hydrochloride C8H15ClN2O2 CAS: 817169-86-1 TRC 250 mg 206€
ASK
Pub
A603860 3-Amino-3-deoxy-1,2:5,6-di-O-isopropylidene-α-D-glucofuranose C12H21NO5 CAS: 24384-84-7 TRC 50 mg 212 A603860 3-Amino-3-deoxy-1,2:5,6-di-O-isopropylidene-α-D-glucofuranose C12H21NO5 CAS: 24384-84-7 TRC 50 mg 212€
ASK
Pub
A603975 6-Amino-6-deoxy-1,2-O-isopropylidene-α-D-glucofuranose Hydrochloride C9H18ClNO5 CAS: 24384-88-1 TRC 50 mg 232 A603975 6-Amino-6-deoxy-1,2-O-isopropylidene-α-D-glucofuranose Hydrochloride C9H18ClNO5 CAS: 24384-88-1 TRC 50 mg 232€
ASK
Pub
A604800 4-Amino-3.4-dideoxy-2-C-(hydroxymethyl)-D-epi-inositol hydrate C7H17NO6 CAS: 83465-22-9 TRC 50 mg 245 A604800 4-Amino-3.4-dideoxy-2-C-(hydroxymethyl)-D-epi-inositol hydrate C7H17NO6 CAS: 83465-22-9 TRC 50 mg 245€
ASK
Pub
A605178 4-Amino-N,1-dimethyl-5-imidazolecarboxamide C6H10N4O CAS: 858221-03-1 TRC 200 mg 193 A605178 4-Amino-N,1-dimethyl-5-imidazolecarboxamide C6H10N4O CAS: 858221-03-1 TRC 200 mg 193€
ASK
Pub
A608995 N-(2-Aminoethyl)-5-isoquinolinesulfonamide C11H13N3O2S CAS: 84468-17-7 TRC 25 mg 193 A608995 N-(2-Aminoethyl)-5-isoquinolinesulfonamide C11H13N3O2S CAS: 84468-17-7 TRC 25 mg 193€
ASK
Pub
A609165 3-(2-Aminoethyl)-N-methyl-1H-indole-5-methanesulfonamide Didesmethyl Sumatriptan C12H17N3O2S CAS: 88919-22-6 TRC 50 mg 245 A609165 3-(2-Aminoethyl)-N-methyl-1H-indole-5-methanesulfonamide Didesmethyl Sumatriptan C12H17N3O2S CAS: 88919-22-6 TRC 50 mg 245€
ASK
Pub
A611650 (3S,4aS,8aS)-2-[(2R,3R)-3-[(3-Amino-2-hydroxy-4-phenythiobutyl]-decahydro-N-(2-hydroxy-1,1-dimethylethyl)-3-isoquinolinecarboxamide C24H39N3O3S CAS: 252186-41-7 TRC 1 mg 180 A611650 (3S,4aS,8aS)-2-[(2R,3R)-3-[(3-Amino-2-hydroxy-4-phenythiobutyl]-decahydro-N-(2-hydroxy-1,1-dimethylethyl)-3-isoquinolinecarboxamide C24H39N3O3S CAS: 252186-41-7 TRC 1 mg 180€
ASK
Pub
A611765 5-Aminoimidazole-4-carboxamide-1-β-D-Ribofuranosyl 5’-Triphosphate DISCONTINUED C9H17N4O14P3 CAS: 82989-82-0 TRC 20 mg 5250 A611765 5-Aminoimidazole-4-carboxamide-1-β-D-Ribofuranosyl 5’-Triphosphate DISCONTINUED C9H17N4O14P3 CAS: 82989-82-0 TRC 20 mg 5250€
ASK
Pub
A611960 5-Amino-6-methylamino-7-methylquinoline C11H13N3 CAS: 83407-42-5 TRC 20 mg 212 A611960 5-Amino-6-methylamino-7-methylquinoline C11H13N3 CAS: 83407-42-5 TRC 20 mg 212€
ASK
Pub
A616190 α-(Aminomethyl)-6-fluoro-3,4-dihydro-2H-1-benzopyran-2-methanol (Mixture of Diastereomers) C11H14FNO2 CAS: 897661-66-4 TRC 25 mg 206 A616190 α-(Aminomethyl)-6-fluoro-3,4-dihydro-2H-1-benzopyran-2-methanol (Mixture of Diastereomers) C11H14FNO2 CAS: 897661-66-4 TRC 25 mg 206€
ASK
Pub
A616275 4-Amino-1-methyl-1H-Imidazole-5-carboxylic Acid C5H7N3O2 CAS: 858512-11-5 TRC 250 mg 245 A616275 4-Amino-1-methyl-1H-Imidazole-5-carboxylic Acid C5H7N3O2 CAS: 858512-11-5 TRC 250 mg 245€
ASK
Pub
A616825 5-(Aminomethyl)indole C9H10N2 CAS: 81881-74-5 TRC 250 mg 206 A616825 5-(Aminomethyl)indole C9H10N2 CAS: 81881-74-5 TRC 250 mg 206€
ASK
Pub
A616850 2-Amino-6-methylnicotinonitrile C7H7N3 CAS: 84647-20-1 TRC 250 mg 310 A616850 2-Amino-6-methylnicotinonitrile C7H7N3 CAS: 84647-20-1 TRC 250 mg 310€
ASK
Pub
A616965 (2S,3S)-3-Amino-2-methyl-4-oxoazetidine-1-sulphonic Acid C4H8N2O4S CAS: 80082-65-1 TRC 1 g 193 A616965 (2S,3S)-3-Amino-2-methyl-4-oxoazetidine-1-sulphonic Acid C4H8N2O4S CAS: 80082-65-1 TRC 1 g 193€
ASK
Pub
A616970 (2R,3S)-3-Amino-2-methyl-4-oxo-1-azetidinesulfonic Acid C4H8N2O4S CAS: 80582-09-8 TRC 50 mg 193 A616970 (2R,3S)-3-Amino-2-methyl-4-oxo-1-azetidinesulfonic Acid C4H8N2O4S CAS: 80582-09-8 TRC 50 mg 193€
ASK
Pub
A622420 2-[(2-Aminophenyl)amino]-5-methyl-3-thiophenecarbonitrile (Olanzapine Impurity) C12H11N3S CAS: 873895-41-1 TRC 25 mg 232 A622420 2-[(2-Aminophenyl)amino]-5-methyl-3-thiophenecarbonitrile (Olanzapine Impurity) C12H11N3S CAS: 873895-41-1 TRC 25 mg 232€
ASK
Pub
A622525 1-(3-Aminophenyl)-3-azetidinecarboxylic Acid Methyl Ester� C11H14N2O2� CAS: 887595-89-3 TRC 250 mg 232 A622525 1-(3-Aminophenyl)-3-azetidinecarboxylic Acid Methyl Ester� C11H14N2O2� CAS: 887595-89-3 TRC 250 mg 232€
ASK
Pub
A622530 3-Aminophenylboronic Acid Monohydrate C6H10BNO3 CAS: 206658-89-1 TRC 2.5 g 232 A622530 3-Aminophenylboronic Acid Monohydrate C6H10BNO3 CAS: 206658-89-1 TRC 2.5 g 232€
ASK
Pub
A626800 9-(4’-Aminophenyl)-9H-pyrido[3,4-b]indole C17H13N3 CAS: 219959-86-1 TRC 5 mg 277 A626800 9-(4’-Aminophenyl)-9H-pyrido[3,4-b]indole C17H13N3 CAS: 219959-86-1 TRC 5 mg 277€
ASK
Pub
A628973 5-Amino-3(2H)-pyridazinone C4H5N3O CAS: 89033-30-7 TRC 5 mg 232 A628973 5-Amino-3(2H)-pyridazinone C4H5N3O CAS: 89033-30-7 TRC 5 mg 232€
ASK
Pub
A629920 2-Amino-4,5,7,8-tetrahydro-6-(N-carbethoxy)thiazolo[5,4-d]azepine C10H15N3O2S CAS: 887352-57-0 TRC 25 mg 212 A629920 2-Amino-4,5,7,8-tetrahydro-6-(N-carbethoxy)thiazolo[5,4-d]azepine C10H15N3O2S CAS: 887352-57-0 TRC 25 mg 212€
ASK
Pub
A629970 2β-Amino-9,10,10aα,10b-tetrahydro-10bβ-hydroxy-5β-isobutyl-2-isopropyl-8H-Oxazolo[3,2-a]pyrrolo[2,1-c]pyrazine-3,6(2H,5H)-dione Hydrochloride Salt C16H28ClN3O4 CAS: 24177-10-4 TRC 1 mg 570 A629970 2β-Amino-9,10,10aα,10b-tetrahydro-10bβ-hydroxy-5β-isobutyl-2-isopropyl-8H-Oxazolo[3,2-a]pyrrolo[2,1-c]pyrazine-3,6(2H,5H)-dione Hydrochloride Salt C16H28ClN3O4 CAS: 24177-10-4 TRC 1 mg 570€
ASK
Pub
A633840 Ammonium 5-(Carbamoyl)isoxazol-3-olate C4H7N3O3 (for monoamonium Salt) CAS: 81965-22-2 TRC 25 mg 193 A633840 Ammonium 5-(Carbamoyl)isoxazol-3-olate C4H7N3O3 (for monoamonium Salt) CAS: 81965-22-2 TRC 25 mg 193€
ASK
Pub
A634000 Ammonium 7-Fluoro-2,1,3-benzoxadiazole-4-sulfonate C6H6FN3O4S CAS: 84806-27-9 TRC 25 mg 245 A634000 Ammonium 7-Fluoro-2,1,3-benzoxadiazole-4-sulfonate C6H6FN3O4S CAS: 84806-27-9 TRC 25 mg 245€
ASK
Pub
A637200 Anacetrapib C30H25F10NO3 CAS: 875446-37-0 TRC 25 mg 8370 A637200 Anacetrapib C30H25F10NO3 CAS: 875446-37-0 TRC 25 mg 8370€
ASK
Pub
A637865 1,6-Anhydro-2,4-di-O-p-toluenesulfonyl-β-D-glucopyranose C20H22O9S2 CAS: 20204-80-2 TRC 100 mg 193 A637865 1,6-Anhydro-2,4-di-O-p-toluenesulfonyl-β-D-glucopyranose C20H22O9S2 CAS: 20204-80-2 TRC 100 mg 193€
ASK
Pub
A638300 9,10-Anhydro Doxorubicin C27H27NO10 CAS: 80996-23-2� TRC 10 mg 5575 A638300 9,10-Anhydro Doxorubicin C27H27NO10 CAS: 80996-23-2� TRC 10 mg 5575€
ASK
Pub
A795260 (1R,3S,5R)-2-Azabicyclo[3.3.0]octane-3-carboxylic Acid C8H13NO2 CAS: 87679-21-8 TRC 10 mg 180 A795260 (1R,3S,5R)-2-Azabicyclo[3.3.0]octane-3-carboxylic Acid C8H13NO2 CAS: 87679-21-8 TRC 10 mg 180€
ASK
Pub
A812490 D,L-Azetidine-2-carboxylic Acid C4H7NO2 CAS: 20063-89-2 TRC 500 mg 212 A812490 D,L-Azetidine-2-carboxylic Acid C4H7NO2 CAS: 20063-89-2 TRC 500 mg 212€
ASK
Pub
A825070 3'-Azido-3'-deoxythymidine 5’-Monophosphate Sodium Salt C10H13N5NaO7P CAS: 29706-85-2 TRC 25 mg 212 A825070 3'-Azido-3'-deoxythymidine 5’-Monophosphate Sodium Salt C10H13N5NaO7P CAS: 29706-85-2 TRC 25 mg 212€
ASK
Pub
A885250 1-Azido-3,6,9-trioxaundecane-11-ol C8H17N3O4 CAS: 86770-67-4 TRC 250 mg 245 A885250 1-Azido-3,6,9-trioxaundecane-11-ol C8H17N3O4 CAS: 86770-67-4 TRC 250 mg 245€
ASK
Pub
A919900 rac-1-Azido-3-(1-naphthalenyloxy)-2-propanol C13H13N3O2 CAS: 87102-64-5 TRC 25 mg 232 A919900 rac-1-Azido-3-(1-naphthalenyloxy)-2-propanol C13H13N3O2 CAS: 87102-64-5 TRC 25 mg 232€
ASK
Pub
AK8217-2507 CryoSolve- Box Kit (25 single-use syringes) Akron 25x7ml 917 AK8217-2507 CryoSolve- Box Kit (25 single-use syringes) Akron 25x7ml 917€
ASK
Pub
AP21179 Rabbit anti DNA PKcs (Ab-2609) AngoiPro 100.00 ul 290 AP21179 Rabbit anti DNA PKcs (Ab-2609) AngoiPro 100.00 ul 290€ Pub
ASIN-001 Hamster Insulin Standard 10ng ml, 250mcl x 5 bottles Shibayagi 5 360 ASIN-001 Hamster Insulin Standard 10ng ml, 250mcl x 5 bottles Shibayagi 5 360€
ASK
Pub
B0001-25 Protein Purification Beads Protein A Beads (1-2mg ml) Boster biotechnology 25ml 718.2 B0001-25 Protein Purification Beads Protein A Beads (1-2mg ml) Boster biotechnology 25ml 718.2€
ASK
Pub
B0002-25 Protein Purification Beads Protein G Beads (1-2mg ml) Boster biotechnology 25ml 1081.5 B0002-25 Protein Purification Beads Protein G Beads (1-2mg ml) Boster biotechnology 25ml 1081.5€
ASK
Pub
B0003-25 Protein Purification Beads Goat Anti-Rabbit IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 904.05 B0003-25 Protein Purification Beads Goat Anti-Rabbit IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 904.05€
ASK
Pub
B0004-25 Protein Purification Beads Goat Anti-Mouse IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 904.05 B0004-25 Protein Purification Beads Goat Anti-Mouse IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 904.05€
ASK
Pub
B0005-25 Protein Purification Beads Rabbit Anti-Human IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 1472.1 B0005-25 Protein Purification Beads Rabbit Anti-Human IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 1472.1€
ASK
Pub
B0006-25 Protein Purification Beads Rabbit Anti-Rat IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 1472.1 B0006-25 Protein Purification Beads Rabbit Anti-Rat IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 1472.1€
ASK
Pub
B0007-25 Protein Purification Beads Mouse Anti-Rabbit IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 904.05 B0007-25 Protein Purification Beads Mouse Anti-Rabbit IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 904.05€
ASK
Pub
B0008-25 Protein Purification Beads Mouse Anti-Human IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 1472.1 B0008-25 Protein Purification Beads Mouse Anti-Human IgG Beads (1-1.5mg ml) Boster biotechnology 25ml 1472.1€
ASK
Pub
B106530 Bacitracin F (>80%) C66H98N16O17S CAS: 22601-63-4 TRC 50 mg 245 B106530 Bacitracin F (>80%) C66H98N16O17S CAS: 22601-63-4 TRC 50 mg 245€
ASK
Pub
B117500 Bambuterol Hydrochloride C18H30ClN3O5 CAS: 81732-46-9 TRC 25 mg 193 B117500 Bambuterol Hydrochloride C18H30ClN3O5 CAS: 81732-46-9 TRC 25 mg 193€
ASK
Pub
B119750 Benazepril Hydrochloride C24H29ClN2O5 CAS: 86541-74-4 TRC 25 mg 193 B119750 Benazepril Hydrochloride C24H29ClN2O5 CAS: 86541-74-4 TRC 25 mg 193€
ASK
Pub
B136000 Benfotiamine C19H23N4O6PS CAS: 22457-89-2 TRC 100 mg 193 B136000 Benfotiamine C19H23N4O6PS CAS: 22457-89-2 TRC 100 mg 193€
ASK
Pub
B197925 Benznidazole C12H12N4O3 CAS: 22994-85-0 TRC 1 g 212 B197925 Benznidazole C12H12N4O3 CAS: 22994-85-0 TRC 1 g 212€
ASK
Pub
B200760 t-Boc-aminooxyacetic Acid N-Hydroxysuccinimide Ester C11H16N2O7 CAS: 80366-85-4 TRC 250 mg 245 B200760 t-Boc-aminooxyacetic Acid N-Hydroxysuccinimide Ester C11H16N2O7 CAS: 80366-85-4 TRC 250 mg 245€
ASK
Pub
B208700 4-Benzoylpiperidine Hydrochloride C12H16ClNO CAS: 25519-80-6 TRC 100 mg 232 B208700 4-Benzoylpiperidine Hydrochloride C12H16ClNO CAS: 25519-80-6 TRC 100 mg 232€
ASK
Pub
B211750 Benzyl 2-Acetamido-2-deoxy-4,6-O-benzylidene-3-O-(2’,3’,4’,6’-tetra- O-acetyl-β-D-galactopyranosyl)-α-D-galactopyranoside C36H43NO15 CAS: 86327-84-6 TRC 25 mg 212 B211750 Benzyl 2-Acetamido-2-deoxy-4,6-O-benzylidene-3-O-(2’,3’,4’,6’-tetra- O-acetyl-β-D-galactopyranosyl)-α-D-galactopyranoside C36H43NO15 CAS: 86327-84-6 TRC 25 mg 212€
ASK
Pub
B233645 Benzyl (2S)-2-carbobenzyloxyamino-6-hydroxyhexanoate C21H25NO5 CAS: 84246-49-1 TRC 25 mg 212 B233645 Benzyl (2S)-2-carbobenzyloxyamino-6-hydroxyhexanoate C21H25NO5 CAS: 84246-49-1 TRC 25 mg 212€
ASK
Pub
B234500 S-Benzyl-L-cysteine Sulfone C10H13NO4S CAS: 25644-88-6 TRC 1 g 232 B234500 S-Benzyl-L-cysteine Sulfone C10H13NO4S CAS: 25644-88-6 TRC 1 g 232€
ASK
Pub
B234833 Benzyl 2-Deoxy-2-phthalimido-4,6-O-benzylidene-β-D-glucopyranoside C28H25NO7 CAS: 80035-33-2 TRC 250 mg 232 B234833 Benzyl 2-Deoxy-2-phthalimido-4,6-O-benzylidene-β-D-glucopyranoside C28H25NO7 CAS: 80035-33-2 TRC 250 mg 232€
ASK
Pub
B235010 Benzyl 2-(Acetylamino)-3-O-[2-(acetylamino)-2-deoxy-β-D-glucopyranosyl]-2-deoxy-α-D-galactopyranoside C23H34N2O11 CAS: 85054-29-1 TRC 1 mg 277 B235010 Benzyl 2-(Acetylamino)-3-O-[2-(acetylamino)-2-deoxy-β-D-glucopyranosyl]-2-deoxy-α-D-galactopyranoside C23H34N2O11 CAS: 85054-29-1 TRC 1 mg 277€
ASK
Pub
B235015 Benzyl 2-(Acetylamino)-2-deoxy-3-O-[3,4,6-tri-O-acetyl-2-(acetylamino)-2-deoxy-β-D-glucopyranosyl]-α-D-galactopyranoside 4,6-Diacetate C33H44N2O16 CAS: 85054-28-0 TRC 1 mg 232 B235015 Benzyl 2-(Acetylamino)-2-deoxy-3-O-[3,4,6-tri-O-acetyl-2-(acetylamino)-2-deoxy-β-D-glucopyranosyl]-α-D-galactopyranoside 4,6-Diacetate C33H44N2O16 CAS: 85054-28-0 TRC 1 mg 232€
ASK
Pub
B276120 Benzyl 2,3-O-[(1S,2S)-1,2-Dimethoxy-1,2-dimethyl-1,2-ethanediyl]-β-D-arabinopyranoside C18H26O7 CAS: 887370-09-4 TRC 100 mg 193 B276120 Benzyl 2,3-O-[(1S,2S)-1,2-Dimethoxy-1,2-dimethyl-1,2-ethanediyl]-β-D-arabinopyranoside C18H26O7 CAS: 887370-09-4 TRC 100 mg 193€
ASK
Pub
B276150 1-Benzyl-4-(5,6-dimethoxy-1-oxoindan-2-yl)methylpyridinium Bromide � C24H24BrNO3 CAS: 231283-82-2� TRC 10 mg 245 B276150 1-Benzyl-4-(5,6-dimethoxy-1-oxoindan-2-yl)methylpyridinium Bromide � C24H24BrNO3 CAS: 231283-82-2� TRC 10 mg 245€
ASK
Pub
B276185 N-Benzyl-7,8-dimethoxy-2,3,4,5-tetrahydro-2-benzazepine-3-one C19H21NO3 CAS: 887352-89-8 TRC 25 mg 232 B276185 N-Benzyl-7,8-dimethoxy-2,3,4,5-tetrahydro-2-benzazepine-3-one C19H21NO3 CAS: 887352-89-8 TRC 25 mg 232€
ASK
Pub
B285870 4-Benzyloxycarbonylaminopiperidine Hydrochloride C13H19ClN2O2 CAS: 207296-89-7 TRC 250 mg 206 B285870 4-Benzyloxycarbonylaminopiperidine Hydrochloride C13H19ClN2O2 CAS: 207296-89-7 TRC 250 mg 206€
ASK
Pub
B285897 (2S,3S)-3-Benzyloxycarbonylamino-2-methyl-4-oxo-1-azetidinesulfonic Acid Tetrabutylammonium Salt C28H49N3O6S CAS: 80082-62-8 TRC 100 mg 212 B285897 (2S,3S)-3-Benzyloxycarbonylamino-2-methyl-4-oxo-1-azetidinesulfonic Acid Tetrabutylammonium Salt C28H49N3O6S CAS: 80082-62-8 TRC 100 mg 212€
ASK
Pub
B285924 N-Benzyloxycarbonyl L-Threonine Amide O-Methanesulfonate C13H18N2O6S CAS: 80082-51-5 TRC 250 mg 212 B285924 N-Benzyloxycarbonyl L-Threonine Amide O-Methanesulfonate C13H18N2O6S CAS: 80082-51-5 TRC 250 mg 212€
ASK
Pub
B285981 4-Benzyloxy-3-methoxybenzaldehyde C15H14O3 CAS: 2426-87-1 TRC 10 g 193 B285981 4-Benzyloxy-3-methoxybenzaldehyde C15H14O3 CAS: 2426-87-1 TRC 10 g 193€
ASK
Pub
B285985 4-Benzyloxy-3-methoxy-6-β-dinitrostyrene C16H14N2O6 CAS: 2426-89-3 TRC 100 mg 206 B285985 4-Benzyloxy-3-methoxy-6-β-dinitrostyrene C16H14N2O6 CAS: 2426-89-3 TRC 100 mg 206€
ASK
Pub
B286025 Benzyl 2-Oxo-4-phenylbutyrate C17H16O3 CAS: 84688-29-9 TRC 10 mg 232 B286025 Benzyl 2-Oxo-4-phenylbutyrate C17H16O3 CAS: 84688-29-9 TRC 10 mg 232€
ASK
Pub
B286050 9-[[2-Benzyloxy-1-(benzyloxymethyl)-ethoxy]-methyl]-6-chloroguanine C23H24ClN5O3 CAS: 84222-47-9 TRC 25 mg 277 B286050 9-[[2-Benzyloxy-1-(benzyloxymethyl)-ethoxy]-methyl]-6-chloroguanine C23H24ClN5O3 CAS: 84222-47-9 TRC 25 mg 277€
ASK
Pub
B286060 N-Benzyloxycarbonyl-4-[(3R)-3-amino-1-oxo-4-(phenylthio)butyl]morpholine C22H26N2O4S CAS: 870812-93-4 TRC 25 mg 232 B286060 N-Benzyloxycarbonyl-4-[(3R)-3-amino-1-oxo-4-(phenylthio)butyl]morpholine C22H26N2O4S CAS: 870812-93-4 TRC 25 mg 232€
ASK
Pub
B286210 N2-Benzyloxycarbonyl-L-homoglutamine C14H18N2O5 CAS: 83793-19-5 TRC 250 mg 193 B286210 N2-Benzyloxycarbonyl-L-homoglutamine C14H18N2O5 CAS: 83793-19-5 TRC 250 mg 193€
ASK
Pub
B286390 4-(Benzyloxy)cyclohexanol (cis trans mixture) C13H18O2 CAS: 2976-80-9 TRC 500 mg 212 B286390 4-(Benzyloxy)cyclohexanol (cis trans mixture) C13H18O2 CAS: 2976-80-9 TRC 500 mg 212€
ASK
Pub
B286495 1-[2-(Benzyloxy)ethyl]-cyclohexanecarboxylic Acid Methyl Ester C17H24O3 CAS: 865459-93-4 TRC 25 mg 193 B286495 1-[2-(Benzyloxy)ethyl]-cyclohexanecarboxylic Acid Methyl Ester C17H24O3 CAS: 865459-93-4 TRC 25 mg 193€
ASK
Pub
B286875 (R)-3-Benzyloxy Myristic Acid C21H34O3 CAS: 87357-67-3 TRC 25 mg 180 B286875 (R)-3-Benzyloxy Myristic Acid C21H34O3 CAS: 87357-67-3 TRC 25 mg 180€
ASK
Pub
BA00205 Atlas HotTaq DNA Polymerase 2500 U BioAtlas 452 BA00205 Atlas HotTaq DNA Polymerase 2500 U BioAtlas 452€ Pub
BB50-DX-CE Bullet Blender 50-DX homogenizer, CE certified, for up to 8 samples in 50 mL tubes, with air cooling and noise insulation. Next Advence 3831 BB50-DX-CE Bullet Blender 50-DX homogenizer, CE certified, for up to 8 samples in 50 mL tubes, with air cooling and noise insulation. Next Advence 3831€
ASK
Pub
BB50AU-CE Homogenizer for 8 samples in 50mL tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Upgraded elect Next Advence 4985 BB50AU-CE Homogenizer for 8 samples in 50mL tubes. Large enclosure to help reduce noise and active cooling to maintain 4C interior temperature. Includes starter kit of beads, scoops and tubes. Upgraded elect Next Advence 4985€
ASK
Pub
BBS-H1300 Horizontal Laminar Flow Clean Bench, Model BBS-H1300; Internal Dims(mm) 1200*500*570 ; External Dims(mm) 1300*825*2000 Biobase 1920 BBS-H1300 Horizontal Laminar Flow Clean Bench, Model BBS-H1300; Internal Dims(mm) 1200*500*570 ; External Dims(mm) 1300*825*2000 Biobase 1920€
ASK
Pub
BBS-H1800 Horizontal Laminar Flow Clean Bench, Model BBS-H1800; Internal Dims(mm) 1700*500*610 ; External Dims(mm) 1800*825*2000 Biobase 2375 BBS-H1800 Horizontal Laminar Flow Clean Bench, Model BBS-H1800; Internal Dims(mm) 1700*500*610 ; External Dims(mm) 1800*825*2000 Biobase 2375€
ASK
Pub
BBX24-CE Bullet Blender homogenizer, CE certified, for up to 24 tissue cell samples in snap cap microcentrifuge tubes. Next Advence 2502 BBX24-CE Bullet Blender homogenizer, CE certified, for up to 24 tissue cell samples in snap cap microcentrifuge tubes. Next Advence 2502€ Pub
BBX24B-CE Bullet Blender homogenizer, CE certified, with air cooling, for up to 24 samples in snap cap microcentrifuge tubes. Next Advence 3093 BBX24B-CE Bullet Blender homogenizer, CE certified, with air cooling, for up to 24 samples in snap cap microcentrifuge tubes. Next Advence 3093€
ASK
Pub
BBX24BW-CE Bullet Blender homogenizer, CE certified, with air cooling, for up to 24 samples in screw cap microcentrifuge tubes. Next Advence 2912 BBX24BW-CE Bullet Blender homogenizer, CE certified, with air cooling, for up to 24 samples in screw cap microcentrifuge tubes. Next Advence 2912€
ASK
Pub
BBX24W-CE Bullet Blender homogenizer, CE certified, for up to 24 tissue cell samples in screw cap microcentrifuge tubes. Next Advence 2502 BBX24W-CE Bullet Blender homogenizer, CE certified, for up to 24 tissue cell samples in screw cap microcentrifuge tubes. Next Advence 2502€
ASK
Pub
BBY24M-CE Bullet Blender Storm. homogenizer, CE certified, with air cooling, for up to 24 samples in snap cap microcentrifuge tubes. Next Advence 3594 BBY24M-CE Bullet Blender Storm. homogenizer, CE certified, with air cooling, for up to 24 samples in snap cap microcentrifuge tubes. Next Advence 3594€ Pub
BIO-21060 BIOTAQ DNA Polymerase Bioline 2500 Units 405 BIO-21060 BIOTAQ DNA Polymerase Bioline 2500 Units 405€ Pub
BIO-21082 MangoTaq DNA Polymerase Bioline 2000 Units 298.62 BIO-21082 MangoTaq DNA Polymerase Bioline 2000 Units 298.62€
ASK
Pub
BIO-21106 MyTaq DNA Polymerase Bioline 2500 Units 380 BIO-21106 MyTaq DNA Polymerase Bioline 2500 Units 380€ Pub
BIO-21109 MyTaq Red DNA Polymerase Bioline 2500 Units 405.405 BIO-21109 MyTaq Red DNA Polymerase Bioline 2500 Units 405.405€ Pub
BIO-21113 MyTaq HS DNA Polymerase Bioline 2500 Units 933.66 BIO-21113 MyTaq HS DNA Polymerase Bioline 2500 Units 933.66€ Pub
BIO-21116 MyTaq HS Red DNA Polymerase Bioline 2500 Units 933.66 BIO-21116 MyTaq HS Red DNA Polymerase Bioline 2500 Units 933.66€ Pub
BIO-21119 MyFi DNA Polymerase Bioline 2500 Units 1332.45 BIO-21119 MyFi DNA Polymerase Bioline 2500 Units 1332.45€ Pub
BIO-21123 Ranger DNA Polymerase Bioline 2500 Units 1383.48 BIO-21123 Ranger DNA Polymerase Bioline 2500 Units 1383.48€ Pub
BIO-35026 Rat Genomic DNA Bioline 500µl @ 200ng/µl 101.446 BIO-35026 Rat Genomic DNA Bioline 500µl @ 200ng/µl 101.446€
ASK
Pub
BIO-37042 DNA kits, Column-free Isolation: SureClean Bioline 1 x 5ml 62 BIO-37042 DNA kits, Column-free Isolation: SureClean Bioline 1 x 5ml 62€
ASK
Pub
BIO-82020 SensiFAST Probe Hi-ROX Kit Bioline 2000 rxns 900.585 BIO-82020 SensiFAST Probe Hi-ROX Kit Bioline 2000 rxns 900.585€ Pub
BIO-84020 SensiFAST Probe Lo-ROX Kit Bioline 2000 rxns 900.585 BIO-84020 SensiFAST Probe Lo-ROX Kit Bioline 2000 rxns 900.585€ Pub
BIO-86020 SensiFAST Probe No-ROX Kit Bioline 2000 rxns 900.585 BIO-86020 SensiFAST Probe No-ROX Kit Bioline 2000 rxns 900.585€ Pub
BIO-92020 SensiFAST SYBR Hi ROX Kit Bioline 2000 rxns 900.585 BIO-92020 SensiFAST SYBR Hi ROX Kit Bioline 2000 rxns 900.585€ Pub
BIO-92020 SensiFAST SYBR Hi ROX Kit Release April 11 Bioline 2000 rxns 900.585 BIO-92020 SensiFAST SYBR Hi ROX Kit Release April 11 Bioline 2000 rxns 900.585€ Pub
BIO-94020 SensiFAST SYBR Lo ROX Kit Bioline 2000 rxns 900.585 BIO-94020 SensiFAST SYBR Lo ROX Kit Bioline 2000 rxns 900.585€ Pub
BIO-94020 SensiFAST SYBR Lo ROX Kit Release April 11 Bioline 2000 rxns 900.585 BIO-94020 SensiFAST SYBR Lo ROX Kit Release April 11 Bioline 2000 rxns 900.585€ Pub
BIO-96020 SensiFAST SYBR & Fluorescein Kit Bioline 2000 rxns 900.585 BIO-96020 SensiFAST SYBR & Fluorescein Kit Bioline 2000 rxns 900.585€ Pub
BIO-96020 SensiFAST SYBR & Fluorescein Kit Release April 11 Bioline 2000 rxns 900.585 BIO-96020 SensiFAST SYBR & Fluorescein Kit Release April 11 Bioline 2000 rxns 900.585€ Pub
BIO-98020 SensiFAST SYBR No ROX Kit Bioline 2000 rxns 900.585 BIO-98020 SensiFAST SYBR No ROX Kit Bioline 2000 rxns 900.585€ Pub
BIO-98020 SensiFAST SYBR No ROX Kit Release April 11 Bioline 2000 rxns 900.585 BIO-98020 SensiFAST SYBR No ROX Kit Release April 11 Bioline 2000 rxns 900.585€ Pub
BQ062A-EACL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Calibrator (2 mL vial) Bioquant 148 BQ062A-EACL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Calibrator (2 mL vial) Bioquant 148€
ASK
Pub
BQ062A-EACN ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Control Set (2 x 2 mL vial) Bioquant 180 BQ062A-EACN ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Control Set (2 x 2 mL vial) Bioquant 180€ Pub
BS-010143-AK SC 18C, Block for 20x0.5 ml + 12x1.5 ml microtubes Biosan 1 539 BS-010143-AK SC 18C, Block for 20x0.5 ml + 12x1.5 ml microtubes Biosan 1 539€
ASK
Pub
BS-010143-BK SC 20C, Block for 20x1.5 ml microtubes Biosan 1 539 BS-010143-BK SC 20C, Block for 20x1.5 ml microtubes Biosan 1 539€
ASK
Pub
BS-010143-CK SC 18 02C, Block for 20x0.2 ml microtubes + 12x1.5 ml microtubes Biosan 1 539 BS-010143-CK SC 18 02C, Block for 20x0.2 ml microtubes + 12x1.5 ml microtubes Biosan 1 539€
ASK
Pub
BS-010143-DK SC 20NC, Block for 20x2 ml microtubes Biosan 1 539 BS-010143-DK SC 20NC, Block for 20x2 ml microtubes Biosan 1 539€
ASK
Pub
BS-010143-EK SC 24C, Block for 24x2 ml microtubes Biosan 1 554 BS-010143-EK SC 24C, Block for 24x2 ml microtubes Biosan 1 554€
ASK
Pub
bs-0206R-PE Rabbit Anti-TSHR (CT) Polyclonal Antibody, PE Conjugated , 84kDa; Isotype IgG; Reactivity Human , Dog , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-0206R-PE Rabbit Anti-TSHR (CT) Polyclonal Antibody, PE Conjugated , 84kDa; Isotype IgG; Reactivity Human , Dog , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€
ASK
Pub
bs-2077R-PE Rabbit Anti-AMP deaminase 1 Polyclonal Antibody, PE Conjugated , 87kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Bovine , Dog , Chicken; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-2077R-PE Rabbit Anti-AMP deaminase 1 Polyclonal Antibody, PE Conjugated , 87kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Bovine , Dog , Chicken; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-2981R-PE Rabbit Anti-IL-8 CXCL8 Polyclonal Antibody, PE Conjugated , 8kDa; Isotype IgG; Reactivity Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-2981R-PE Rabbit Anti-IL-8 CXCL8 Polyclonal Antibody, PE Conjugated , 8kDa; Isotype IgG; Reactivity Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-2992R-AF350 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 350 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-2992R-AF350 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 350 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€
ASK
Pub
bs-2992R-AF488 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 488 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-2992R-AF488 Rabbit Anti-MLK3 Polyclonal Antibody, Alexa Fluor 488 Conjugated, 94kDa; Isotype IgG; Reactivity Human , Rat , Mouse; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€
ASK
Pub
bs-3280R-FITC Rabbit Anti-Phospho-MLK3(Thr277 Ser281) Polyclonal Antibody, FITC Conjugated, 90-100kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Bovine , Dog , GuineaPig , Rabbit; Application Flow-Cyt(1 20- Bioss 100ug Lyophilized 550 bs-3280R-FITC Rabbit Anti-Phospho-MLK3(Thr277 Ser281) Polyclonal Antibody, FITC Conjugated, 90-100kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Bovine , Dog , GuineaPig , Rabbit; Application Flow-Cyt(1 20- Bioss 100ug Lyophilized 550€ Pub
bs-6776R-PE Rabbit Anti-FASTKD5 Polyclonal Antibody, PE Conjugated , 87kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-6776R-PE Rabbit Anti-FASTKD5 Polyclonal Antibody, PE Conjugated , 87kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-6776R-PE-Cy3 Rabbit Anti-FASTKD5 Polyclonal Antibody, PE-Cy3 Conjugated , 87kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-6776R-PE-Cy3 Rabbit Anti-FASTKD5 Polyclonal Antibody, PE-Cy3 Conjugated , 87kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
bs-6781R-PE Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-6781R-PE Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-6781R-PE-Cy3 Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE-Cy3 Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-6781R-PE-Cy3 Rabbit Anti-MLK2 MAP3K10 Polyclonal Antibody, PE-Cy3 Conjugated , 103kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Xenopuslaevis; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
bs-6843R-PE Rabbit Anti-MAGED1 Polyclonal Antibody, PE Conjugated , 85kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-6843R-PE Rabbit Anti-MAGED1 Polyclonal Antibody, PE Conjugated , 85kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-6843R-PE-Cy3 Rabbit Anti-MAGED1 Polyclonal Antibody, PE-Cy3 Conjugated , 85kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-6843R-PE-Cy3 Rabbit Anti-MAGED1 Polyclonal Antibody, PE-Cy3 Conjugated , 85kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
bs-6845R-PE Rabbit Anti-NOX5 Polyclonal Antibody, PE Conjugated , 86kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-6845R-PE Rabbit Anti-NOX5 Polyclonal Antibody, PE Conjugated , 86kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-6845R-PE-Cy3 Rabbit Anti-NOX5 Polyclonal Antibody, PE-Cy3 Conjugated , 86kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-6845R-PE-Cy3 Rabbit Anti-NOX5 Polyclonal Antibody, PE-Cy3 Conjugated , 86kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
bs-7601R-PE Rabbit Anti-phospho-IKKi IKKe(Thr500) Polyclonal Antibody, PE Conjugated , 80kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Pig; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 550 bs-7601R-PE Rabbit Anti-phospho-IKKi IKKe(Thr500) Polyclonal Antibody, PE Conjugated , 80kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Pig; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 550€ Pub
bs-7601R-PE-Cy3 Rabbit Anti-phospho-IKKi IKKe(Thr500) Polyclonal Antibody, PE-Cy3 Conjugated , 80kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Pig; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 577 bs-7601R-PE-Cy3 Rabbit Anti-phospho-IKKi IKKe(Thr500) Polyclonal Antibody, PE-Cy3 Conjugated , 80kDa; Isotype IgG; Reactivity Human , Mouse , Rat , Pig; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 577€ Pub
bs-7653R-PE Rabbit Anti-DNase gamma Polyclonal Antibody, PE Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-7653R-PE Rabbit Anti-DNase gamma Polyclonal Antibody, PE Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-7653R-PE-Cy3 Rabbit Anti-DNase gamma Polyclonal Antibody, PE-Cy3 Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-7653R-PE-Cy3 Rabbit Anti-DNase gamma Polyclonal Antibody, PE-Cy3 Conjugated , 36kDa; Isotype IgG; Reactivity Human , Mouse , Rat; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
bs-7684R-PE Rabbit Anti-ALS2CR8 Polyclonal Antibody, PE Conjugated , 81kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502 bs-7684R-PE Rabbit Anti-ALS2CR8 Polyclonal Antibody, PE Conjugated , 81kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 502€ Pub
bs-7684R-PE-Cy3 Rabbit Anti-ALS2CR8 Polyclonal Antibody, PE-Cy3 Conjugated , 81kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530 bs-7684R-PE-Cy3 Rabbit Anti-ALS2CR8 Polyclonal Antibody, PE-Cy3 Conjugated , 81kDa; Isotype IgG; Reactivity Human; Application Flow-Cyt(1 20-100), IF(1 50-200) Bioss 100ug Lyophilized 530€ Pub
C1801-230V-EU NEW Prism Mini Centrifuge complete with 8 place 1.5 2.0ml rotor and 4 place PCR strip rotor, 230V, EU cord Labnet International Inc. 1 336 C1801-230V-EU NEW Prism Mini Centrifuge complete with 8 place 1.5 2.0ml rotor and 4 place PCR strip rotor, 230V, EU cord Labnet International Inc. 1 336€
ASK
Pub
C1801-230V-EU Prism Mini Centrifuge complete with 8 place 1.5 2.0ml rotor and 4 place PCR strip rotor, 230V, EU cord Labnet International Inc. 279 C1801-230V-EU Prism Mini Centrifuge complete with 8 place 1.5 2.0ml rotor and 4 place PCR strip rotor, 230V, EU cord Labnet International Inc. 279€
ASK
Pub
CL-300 ProtoGlow ECL AGTC Bioproducts Ltd 200ml kit 225 CL-300 ProtoGlow ECL AGTC Bioproducts Ltd 200ml kit 225€ Pub
CSB-EL012362HU Human Killer cell immunoglobulin-like receptor 2DS4(KIR2DS4) ELISA kit SpeciesHuman Cusabio 96T 816 CSB-EL012362HU Human Killer cell immunoglobulin-like receptor 2DS4(KIR2DS4) ELISA kit SpeciesHuman Cusabio 96T 816€
ASK
Pub
CSL-multiFUGE multiFUGE Mini Centrifuge with duoROTOR for microtubes and PCR strips tubes Cleaver 324 CSL-multiFUGE multiFUGE Mini Centrifuge with duoROTOR for microtubes and PCR strips tubes Cleaver 324€
ASK
Pub
D-1020 25 100 bp mixed DNA Ladder 100 2,000 bp Bioneer 250ul (150 ng/ul) 209 D-1020 25 100 bp mixed DNA Ladder 100 2,000 bp Bioneer 250ul (150 ng/ul) 209€ Pub
D-1030-1 AccuLadder 100 bp DNA Size Marker 100 2,000 bp Bioneer 315 ul x 2 tubes (54 ng/ul) 227 D-1030-1 AccuLadder 100 bp DNA Size Marker 100 2,000 bp Bioneer 315 ul x 2 tubes (54 ng/ul) 227€ Pub
D1109-100 1Kb PCR Ranger DNA Marker, 750bp To 20Kb GenDepot 1ml 121.8 D1109-100 1Kb PCR Ranger DNA Marker, 750bp To 20Kb GenDepot 1ml 121.8€
ASK
Pub
DEV9922 Corticosterone rat mouse ELISA Standard range: 15 - 2250 ng ml Gentaur 96 tests 286 DEV9922 Corticosterone rat mouse ELISA Standard range: 15 - 2250 ng ml Gentaur 96 tests 286€ Pub
DIAP-250 QuantiChrom™ BCP Albumin Assay Kit, Quantitative determination of albumin by bromcresol purple BCP method at 610nm Bioassays 250Tests 299 DIAP-250 QuantiChrom™ BCP Albumin Assay Kit, Quantitative determination of albumin by bromcresol purple BCP method at 610nm Bioassays 250Tests 299€ Pub
DIAP-250 QuantiChrom™ BCP Albumin Assay Kit, Quantitative determination of albumin by bromcresol purple BCP method at 610nm. Procedure 5 min. Kit size 250 tests. Detection limit 0.3 g dL. Shelf life 12 mon Bioassays 250tests 299 DIAP-250 QuantiChrom™ BCP Albumin Assay Kit, Quantitative determination of albumin by bromcresol purple BCP method at 610nm. Procedure 5 min. Kit size 250 tests. Detection limit 0.3 g dL. Shelf life 12 mon Bioassays 250tests 299€ Pub
DS-PB-00209 Rabbit Anti-Human ATM (aa 1980-2338) Antibodies Ray Biotech 0.1 ml 452 DS-PB-00209 Rabbit Anti-Human ATM (aa 1980-2338) Antibodies Ray Biotech 0.1 ml 452€
ASK
Pub
DS-PB-00210 Rabbit Anti-Human ATR (aa 2122-2380) Antibodies Ray Biotech 0.1 ml 452 DS-PB-00210 Rabbit Anti-Human ATR (aa 2122-2380) Antibodies Ray Biotech 0.1 ml 452€
ASK
Pub
DS-PB-00211 Rabbit Anti-Human ATR (aa 2122-2644) Antibodies Ray Biotech 0.1 ml 452 DS-PB-00211 Rabbit Anti-Human ATR (aa 2122-2644) Antibodies Ray Biotech 0.1 ml 452€
ASK
Pub
DS-PB-00212 Rabbit Anti-Human ATR (aa 2381-2644) Antibodies Ray Biotech 0.1 ml 452 DS-PB-00212 Rabbit Anti-Human ATR (aa 2381-2644) Antibodies Ray Biotech 0.1 ml 452€
ASK
Pub
DS-PB-00350 Rabbit Anti-C. jejuni ATCC 29428 [+Biotin] Antibodies Ray Biotech 1 ml 452 DS-PB-00350 Rabbit Anti-C. jejuni ATCC 29428 [+Biotin] Antibodies Ray Biotech 1 ml 452€
ASK
Pub
DS-PB-00351 Rabbit Anti-C. jejuni ATCC 29428 [+FITC] Antibodies Ray Biotech 1 ml 452 DS-PB-00351 Rabbit Anti-C. jejuni ATCC 29428 [+FITC] Antibodies Ray Biotech 1 ml 452€
ASK
Pub
DS-PB-00352 Rabbit Anti-C. jejuni ATCC 29428 [+HRP] Antibodies Ray Biotech 1 ml 510 DS-PB-00352 Rabbit Anti-C. jejuni ATCC 29428 [+HRP] Antibodies Ray Biotech 1 ml 510€
ASK
Pub
DS-PB-00617 Rabbit Anti-Bovine DNAse 1 Antibodies Ray Biotech 1 ml 485 DS-PB-00617 Rabbit Anti-Bovine DNAse 1 Antibodies Ray Biotech 1 ml 485€
ASK
Pub
DS-PB-01307 Sheep Anti-Human MDC1 (aa 1883-2089) Antibodies Ray Biotech 0.1 ml 518 DS-PB-01307 Sheep Anti-Human MDC1 (aa 1883-2089) Antibodies Ray Biotech 0.1 ml 518€
ASK
Pub
DS-PB-02775 Rabbit Anti-Human TRRAP (aa 2824-2950) Antibodies Ray Biotech 0.1 ml 452 DS-PB-02775 Rabbit Anti-Human TRRAP (aa 2824-2950) Antibodies Ray Biotech 0.1 ml 452€
ASK
Pub
E-1801 Mar I (Mly113 I) Bioneer 200 unit 113 E-1801 Mar I (Mly113 I) Bioneer 200 unit 113€ Pub
E-3061 Includes 10 X reaction buffer, 100mM MgCl2, 50mM DTT, 10mM ATP, 25 ug mL BSA Bioneer 20000 Units 90 E-3061 Includes 10 X reaction buffer, 100mM MgCl2, 50mM DTT, 10mM ATP, 25 ug mL BSA Bioneer 20000 Units 90€ Pub
E-3111 Tfi DNA Ligase Includes with dNTPs Bioneer 2000 Units 115 E-3111 Tfi DNA Ligase Includes with dNTPs Bioneer 2000 Units 115€ Pub
E3500B-250U ACTGene Blue Hot Start DNA Poly, 250U vial ACTGene per vial 101 E3500B-250U ACTGene Blue Hot Start DNA Poly, 250U vial ACTGene per vial 101€
ASK
Pub
EIA-ACRP-1 Human Mouse Rat ACRP30 EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-ACRP-1 Human Mouse Rat ACRP30 EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-ADPN-1 Human Mouse Rat ADPN EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-ADPN-1 Human Mouse Rat ADPN EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-ANGII-1 Human Mouse Rat ANGII EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-ANGII-1 Human Mouse Rat ANGII EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-ANP-1 Human Mouse Rat ANP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-ANP-1 Human Mouse Rat ANP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-APC-1 Human Mouse Rat Apelin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-APC-1 Human Mouse Rat Apelin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-BNP-1 Human Mouse Rat BNP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-BNP-1 Human Mouse Rat BNP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-CART-1 Human Mouse Rat CART EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-CART-1 Human Mouse Rat CART EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-CCK-1 Human Mouse Rat CCK EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-CCK-1 Human Mouse Rat CCK EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-CPE-1 Human Mouse Rat C-Peptide EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-CPE-1 Human Mouse Rat C-Peptide EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-GAS-1 Human Mouse Rat Gastrin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-GAS-1 Human Mouse Rat Gastrin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-GHR-1 Human Mouse Rat Ghrelin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-GHR-1 Human Mouse Rat Ghrelin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-GIP-1 Human Mouse Rat GIP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-GIP-1 Human Mouse Rat GIP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-GLP1-1 Human Mouse Rat GLP-1 EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-GLP1-1 Human Mouse Rat GLP-1 EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-GLU-1 Human Mouse Rat Glucagon EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-GLU-1 Human Mouse Rat Glucagon EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-INB-1 Human Mouse Rat Inhibin-B EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-INB-1 Human Mouse Rat Inhibin-B EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-NEA-1 Human Mouse Rat Neurokinin-A EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-NEA-1 Human Mouse Rat Neurokinin-A EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-NEB-1 Human Mouse Rat Neurokinin-B EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-NEB-1 Human Mouse Rat Neurokinin-B EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-NES-1 Human Mouse Rat Nesfatin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-NES-1 Human Mouse Rat Nesfatin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-NPY-1 Human Mouse Rat NPY EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-NPY-1 Human Mouse Rat NPY EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-OBS-1 Human Mouse Rat Obestatin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-OBS-1 Human Mouse Rat Obestatin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-pGLU-1 Human Mouse Rat Pro-Glucagon EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-pGLU-1 Human Mouse Rat Pro-Glucagon EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-PTH-1 Human Mouse Rat PTH-RP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-PTH-1 Human Mouse Rat PTH-RP EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-PYY-1 Human Mouse Rat PYY EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-PYY-1 Human Mouse Rat PYY EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-RBP-1 Human Mouse Rat RBP-4 EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-RBP-1 Human Mouse Rat RBP-4 EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-RES-1 Human Mouse Rat Resistin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-RES-1 Human Mouse Rat Resistin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-VAP-1 Human Mouse Rat Vaspin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-VAP-1 Human Mouse Rat Vaspin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-VIS-1 Human Mouse Rat Visfatin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-VIS-1 Human Mouse Rat Visfatin EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
EIA-ZAG-1 Human Mouse Rat ZAG EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345 EIA-ZAG-1 Human Mouse Rat ZAG EIA ELISA Ray Biotech One 96-Well Strip Microplate Kit 345€ Pub
ELB-IFNgamma-001 Custom Bovine IFN-gamma ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELB-IFNgamma-001 Custom Bovine IFN-gamma ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELB-IL2-001 Custom Bovine IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELB-IL2-001 Custom Bovine IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELB-TNFalpha-001 Custom Bovine TNF-alpha ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELB-TNFalpha-001 Custom Bovine TNF-alpha ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELC-HGFR-001 Custom Canine HGF R ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELC-HGFR-001 Custom Canine HGF R ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELC-IFNgamma-001 Custom Canine IFN-gamma ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELC-IFNgamma-001 Custom Canine IFN-gamma ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELC-IL2-001 Custom Canine IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELC-IL2-001 Custom Canine IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELC-IL6-001 Custom Canine IL-6 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELC-IL6-001 Custom Canine IL-6 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELC-IL8-001 Canine IL-8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELC-IL8-001 Canine IL-8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELC-RAGE-001 Custom Canine RAGE ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELC-RAGE-001 Custom Canine RAGE ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELC-SCF-001 Custom Canine SCF Ligand ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELC-SCF-001 Custom Canine SCF Ligand ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELC-TNFalpha-001 Custom Canine TNF-alpha ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELC-TNFalpha-001 Custom Canine TNF-alpha ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELE-IFNgamma-001 Custom Equine IFN-gamma ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELE-IFNgamma-001 Custom Equine IFN-gamma ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELE-IL2-001 Custom Equine IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELE-IL2-001 Custom Equine IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELE-IL4-001 Custom Equine IL-4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELE-IL4-001 Custom Equine IL-4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELF-IL1beta-001 Custom Feline IL-1 beta ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELF-IL1beta-001 Custom Feline IL-1 beta ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELF-IL2-001 Custom Feline IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELF-IL2-001 Custom Feline IL-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELF-IL4-001 Custom Feline IL-4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELF-IL4-001 Custom Feline IL-4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELF-IL5-001 Custom Feline IL-5 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELF-IL5-001 Custom Feline IL-5 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELF-IL8-001 Custom Feline IL-8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELF-IL8-001 Custom Feline IL-8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELF-RANTES-001 Custom Feline RANTES ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELF-RANTES-001 Custom Feline RANTES ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€
ASK
Pub
ELH-6ckine-001 Custom Human 6Ckine ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-6ckine-001 Custom Human 6Ckine ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-ActivinA-001 Human Activin A ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-ActivinA-001 Human Activin A ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-ADAM9-001 Human ADAM9 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-ADAM9-001 Human ADAM9 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-Adipsin-001 Human Adipsin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Adipsin-001 Human Adipsin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-AFP-001 Custom Human AFP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-AFP-001 Custom Human AFP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-AgRP-001 Custom Human AgRP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-AgRP-001 Custom Human AgRP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-ALCAM-001 Human ALCAM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-ALCAM-001 Human ALCAM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-AMICA-001 Custom Human AMICA ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-AMICA-001 Custom Human AMICA ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-ANG-001 Human ANG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-ANG-001 Human ANG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Angiopoietin1-001 Human ANGPT1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Angiopoietin1-001 Human ANGPT1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€
ASK
Pub
ELH-Angiopoietin2-001 Human ANGPT2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Angiopoietin2-001 Human ANGPT2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€
ASK
Pub
ELH-Angiopoietin4-001 Custom Human ANGPT4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Angiopoietin4-001 Custom Human ANGPT4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Angiostatin-001 Human Angiostatin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Angiostatin-001 Human Angiostatin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-ANGPTL4-001 Human ANGPTL4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-ANGPTL4-001 Human ANGPTL4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-APRIL-001 Custom Human APRIL ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-APRIL-001 Custom Human APRIL ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-AR-001 Human AREG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-AR-001 Human AREG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-AXL-001 Human Axl ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-AXL-001 Human Axl ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-bad-001 Custom Human BAD ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677 ELH-bad-001 Custom Human BAD ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677€ Pub
ELH-bax-001 Custom Human BAX ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677 ELH-bax-001 Custom Human BAX ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677€ Pub
ELH-BCAM-001 Human BCAM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-BCAM-001 Human BCAM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Bclw-001 Custom Human Bcl-w ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677 ELH-Bclw-001 Custom Human Bcl-w ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677€ Pub
ELH-BDNF-001 Human BDNF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-BDNF-001 Human BDNF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Beta2M-001 Human B2M ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Beta2M-001 Human B2M ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-betaIGH3-001 Human BIGH3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-betaIGH3-001 Human BIGH3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-bFGF-001 Human bFGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-bFGF-001 Human bFGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-bFGF-001C Human FGF ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-bFGF-001C Human FGF ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-BID-001 Custom Human BID ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677 ELH-BID-001 Custom Human BID ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677€ Pub
ELH-BLAME-001 Custom Human SLAMF8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-BLAME-001 Custom Human SLAMF8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-BLC-001 Human BLC ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-BLC-001 Human BLC ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-BMP4-001C Human BMP-4 ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-BMP4-001C Human BMP-4 ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-BNGF-001 Human beta-NGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-BNGF-001 Human beta-NGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-BTC-001 Human BTC ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-BTC-001 Human BTC ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-CA15-3-001 Human CA15-3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CA15-3-001 Human CA15-3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CA19-9-001 Human CA19-9 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CA19-9-001 Human CA19-9 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CA9-001 Human CA9 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CA9-001 Human CA9 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CathepsinL-001 Custom Human Cathepsin L ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CathepsinL-001 Custom Human Cathepsin L ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CathepsinS-001 Human Cathepsin S ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-CathepsinS-001 Human Cathepsin S ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-CCC5a-001 Custom Human C5a ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CCC5a-001 Custom Human C5a ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CCL28-001 Human CCL28 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CCL28-001 Human CCL28 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CD163-001 Human CD163 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CD163-001 Human CD163 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€
ASK
Pub
ELH-CD200-001 Human CD200 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CD200-001 Human CD200 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CD23-001 Human CD23 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CD23-001 Human CD23 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CD26-001 Human CD26 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CD26-001 Human CD26 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CD30-001 Human CD30 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CD30-001 Human CD30 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CD40L-001 Human CD40L ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CD40L-001 Human CD40L ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CD97-001 Custom Human CD97 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CD97-001 Custom Human CD97 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CEA-001 Human CEA ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CEA-001 Human CEA ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Chemerin-001 Human Chemerin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-Chemerin-001 Human Chemerin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-cIAP2-001 Custom Human cIAP2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677 ELH-cIAP2-001 Custom Human cIAP2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677€ Pub
ELH-CKbeta8-1-001 Custom Human Ckbeta8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CKbeta8-1-001 Custom Human Ckbeta8 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Clusterin-001 Custom Human Clusterin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Clusterin-001 Custom Human Clusterin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CNTF-001 Human CNTF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CNTF-001 Human CNTF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CoagFIII-001 Custom Human Coagulation Factor III ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CoagFIII-001 Custom Human Coagulation Factor III ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-COCO-001 Custom Human COCO ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-COCO-001 Custom Human COCO ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Cripto1-001 Custom Human Cripto-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Cripto1-001 Custom Human Cripto-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CRP-001 Human CRP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CRP-001 Human CRP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CRTAM-001 Custom Human CRTAM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CRTAM-001 Custom Human CRTAM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CT1-001 Human CT-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CT1-001 Human CT-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-CTACK-001 Human CTACK ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CTACK-001 Human CTACK ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CXCL16-001 Human CXCL16 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-CXCL16-001 Human CXCL16 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-CystatinC-001 Human Cystatin C ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-CystatinC-001 Human Cystatin C ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-DAN-001 Human DAN ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-DAN-001 Human DAN ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-DcR3-001 Custom Human DcR3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-DcR3-001 Custom Human DcR3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Decorin-001 Human Decorin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-Decorin-001 Human Decorin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-DLL1-001 Custom Human DLL1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-DLL1-001 Custom Human DLL1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-DR6-001 Custom Human DR6 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-DR6-001 Custom Human DR6 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Dtk-001 Custom Human Dtk ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Dtk-001 Custom Human Dtk ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-ECadherin-001 Custom Human E-Cadherin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-ECadherin-001 Custom Human E-Cadherin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-EDAA2-001 Custom Human EDA-A2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-EDAA2-001 Custom Human EDA-A2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-EGF-001 Human EGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-EGF-001 Human EGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-EGVEGF-001 Human EG-VEGF Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-EGVEGF-001 Human EG-VEGF Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-ENA78-001 Human ENA-78 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-ENA78-001 Human ENA-78 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Endoglin-001 Human Endoglin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Endoglin-001 Human Endoglin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Endostatin-001 Human Endostatin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Endostatin-001 Human Endostatin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Eotaxin-001 Human Eotaxin-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Eotaxin-001 Human Eotaxin-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Eotaxin2-001 Human Eotaxin-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Eotaxin2-001 Human Eotaxin-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Eotaxin3-001 Custom Human Eotaxin-3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Eotaxin3-001 Custom Human Eotaxin-3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-ErbB2-001 Human ErbB2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-ErbB2-001 Human ErbB2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-ErbB3-001 Human ErbB3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-ErbB3-001 Human ErbB3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Eselectin-001 Human E-Selectin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Eselectin-001 Human E-Selectin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-FABP2-001 Custom Human FABP2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-FABP2-001 Custom Human FABP2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-FAP-001 Custom Human FAP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-FAP-001 Custom Human FAP ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Fas-001 Human Fas ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Fas-001 Human Fas ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Fas-001C Human Fas ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Fas-001C Human Fas ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-FASL-001 Human FasL ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-FASL-001 Human FasL ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-FcgRIIBC-001 Human FcgRIIBC ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-FcgRIIBC-001 Human FcgRIIBC ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Ferritin-001 Human Ferritin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Ferritin-001 Human Ferritin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-FetuinA-001 Human Fetuin A ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-FetuinA-001 Human Fetuin A ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-FetuinB-001 Custom Human Fetuin B ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-FetuinB-001 Custom Human Fetuin B ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-FGF4-001C Human FGF-4 ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-FGF4-001C Human FGF-4 ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-FLRG-001 Human FLRG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-FLRG-001 Human FLRG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-Follistatin-001 Human Follistatin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Follistatin-001 Human Follistatin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-FOLR1-001 Custom Human FOLR1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-FOLR1-001 Custom Human FOLR1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Fractalkine-001 Human Fractalkine ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Fractalkine-001 Human Fractalkine ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-FSH-001 Custom Human FSH ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-FSH-001 Custom Human FSH ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Furin-001 Human Furin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-Furin-001 Human Furin ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-Galectin3-001 Custom Human Galectin-3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Galectin3-001 Custom Human Galectin-3 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-Galectin7-001 Human Galectin-7 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-Galectin7-001 Human Galectin-7 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-Gas1-001 Custom Human Gas 1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-Gas1-001 Custom Human Gas 1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-GASP1-001 Custom Human GASP-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-GASP1-001 Custom Human GASP-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-GASP2-001 Custom Human GASP-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-GASP2-001 Custom Human GASP-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-GCSFR-001 Custom Human G-CSF R ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-GCSFR-001 Custom Human G-CSF R ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-GDF15-001 Human GDF-15 Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-GDF15-001 Human GDF-15 Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-GDNF-001 Human GDNF Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-GDNF-001 Human GDNF Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-GH-001 Human GH ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-GH-001 Human GH ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-GITR-001 Human GITR ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-GITR-001 Human GITR ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-GITR-001C Human GITR ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-GITR-001C Human GITR ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-GITRL-001 Human GITR L ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-GITRL-001 Human GITR L ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-GROalpha-001 Human GRO-alpha ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-GROalpha-001 Human GRO-alpha ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-HAI1-001 Custom Human HAI-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-HAI1-001 Custom Human HAI-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-HAI2-001 Custom Human HAI-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-HAI2-001 Custom Human HAI-2 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-HCC1-001 Human HCC-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-HCC1-001 Human HCC-1 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-HCC4-001 Human HCC-4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-HCC4-001 Human HCC-4 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-hCG-001 Human hCG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-hCG-001 Human hCG ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-HGF-001 Human HGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-HGF-001 Human HGF ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-HGF-001C Human HGF ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362 ELH-HGF-001C Human HGF ELISA (For Lysates) ELISA Ray Biotech One 96-Well Strip Microplate Kit 362€ Pub
ELH-HGFR-001 Custom Human HGF R ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542 ELH-HGFR-001 Custom Human HGF R ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 542€ Pub
ELH-HSP27-001 Human HSP27 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-HSP27-001 Human HSP27 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-HSP70-001 Custom Human HSP70 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677 ELH-HSP70-001 Custom Human HSP70 ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 677€ Pub
ELH-HTRA2-001 Human HTRA2 Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-HTRA2-001 Human HTRA2 Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
ELH-HVEM-001 Human HVEM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498 ELH-HVEM-001 Human HVEM ELISA ELISA Ray Biotech One 96-Well Strip Microplate Kit 498€ Pub
  Cat_Number Product name Supplier Quantity Price PDF Pub