Only in Titles

           Search results for: AllHPLC Luciferase GL2   

paperclip

#26134763   // Save this To Up

Synthetic siRNAs effectively target cystein protease 12 and α-actinin transcripts in Trichomonas vaginalis.

The flagellated protozoan Trichomonas vaginalis (T. vaginalis) causes trichomoniasis, a reproductive tract infection, in humans. Trichomoniasis is the most common non-viral sexually transmitted disease worldwide. In addition to direct consequences such as infertility and abortion, there are indications that trichomoniasis favours development of prostate cancer and it has also been associated with increased risk of spreading human immunodeficiency virus and papillomavirus infections. Reports from around the world show that the rate of drug resistance in T. vaginalis is increasing, and therefore new therapeutic approaches have to be developed. Studying molecular biology of T. vaginalis will be quite helpful in identifying new drugable targets. RNAi is a powerful technique which allows biologist to specifically target gene products (i.e. mRNA) helping them in unravelling gene functions and biology of systems. However, due to lack of some parts of the required intrinsic RNAi machinery, the RNAi system is not functional in all orders of life. Here, by using synthetic siRNAs targeting two genes, i.e. α-actinin and cystein protease 12 (cp12), we demonstrate T. vaginalis cells are amenable to RNAi experiments conducted by extrinsic siRNAs. Electroporation of siRNAs targeting α-actinin or cp12 into T. vaginalis cells resulted in, respectively, 48-67% and 33-72% downregulation of the cognate transcripts compared to the T. vaginalis cells received siRNAs targeting GL2 luciferase as a control. This finding is helpful in that it demonstrates the potential of using extrinsically induced RNAi in studies on molecular biology of T. vaginalis such as those aiming at identifying new drug targets.

1699 related Products with: Synthetic siRNAs effectively target cystein protease 12 and α-actinin transcripts in Trichomonas vaginalis.

Hamster AntiSerine Protea Hamster AntiSerine Protea Insulin 1 (Rat), syntheti Caspase-12 Inhibitor Z-AT Caspase-12 Inhibitor Z-AT Caspase 12 Inhibitor 100 Caspase 12 Inhibitor Z AT Caspase-12 Inhibitor Z-AT Caspase-12 Inhibitor Z-AT Caspase 12 Inhibitor 20 u Caspase 12 Inhibitor Z AT Rat Anti-Mouse Interleuki

Related Pathways

paperclip

#20346530   // Save this To Up

In vivo silencing of Reptin blocks the progression of human hepatocellular carcinoma in xenografts and is associated with replicative senescence.

We previously showed that Reptin is overexpressed in hepatocellular carcinoma (HCC), and that in vitro depletion of Reptin with siRNAs led to HCC cell growth arrest and apoptosis. Here, we asked whether in vivo targeting of Reptin in established tumours had a therapeutic effect.

1309 related Products with: In vivo silencing of Reptin blocks the progression of human hepatocellular carcinoma in xenografts and is associated with replicative senescence.

Anti AGO2 Human, Monoclon Anti AGO2 Human, Monoclon Anti AGO2 Mouse, Monoclon Anti AGO2 Mouse, Monoclon Goat Anti-Human Laforin ( interleukin 17 receptor C Human breast invasive duc Thermal Shaker with cooli Rabbit Anti-intestinal FA Rabbit Anti-APIP Apaf1 In Rabbit Anti-APIP Apaf1 In Rabbit Anti-TNIP2 ABIN2 T

Related Pathways

paperclip

#17932986   // Save this To Up

Potential use of polyamidoamine dendrimer/alpha-cyclodextrin conjugate (generation 3, G3) as a novel carrier for short hairpin RNA-expressing plasmid DNA.

The potential of starburst polyamidoamine dendrimer (dendrimer, generation 3, G3) conjugate with alpha-cyclodextrin (alpha-CyD) having an average degree of substitution of 2.4 (alpha-CDE) as a novel carrier of short hairpin RNA (shRNA) expressing plasmid DNA (shpDNA) was evaluated and the shpDNA transfer activity of alpha-CDE was compared with that of dendrimer (G3). Alpha-CDE formed a stable and condensed complex with shpDNA and induced a conformational transition of shpDNA in solution even in the low charge ratios. In addition, alpha-CDE markedly inhibited the enzymatic degradation of shpDNA by DNase I. The shpDNA complex with alpha-CDE at the charge ratio of 20/1 (alpha-CDE/shpDNA) elicited the most potent RNAi effects in cells transiently and stably expressing the GL3 and GL2 luciferase genes without cytotoxicity among the complexes with the various charge ratios. Besides, the RNAi effects were strikingly enhanced by the further addition of the adequate amounts of siRNA to the shpDNA complex with alpha-CDE. Taken together, the prominent RNAi effects of the shpDNA complex with alpha-CDE could be attributed to the stabilizing effect of alpha-CDE on enzymatic degradation of shpDNA and negligible cytotoxicity. These results suggest that alpha-CDE possesses the potential to be a novel carrier for shpDNA and siRNA.

1178 related Products with: Potential use of polyamidoamine dendrimer/alpha-cyclodextrin conjugate (generation 3, G3) as a novel carrier for short hairpin RNA-expressing plasmid DNA.

Glucose Assay With the La ReadiUse™ ABTS Solution Amplite™ Fluorimetric G Amplite™ Fluorimetric G Cell Meter™ JC 10 Mitoc Cell Meter™ JC 10 Mitoc Cell Meter™ NIR Mitocho Cell Meter™ NIR Mitocho Cell Meter™ Mitochondri Primary antibody FLIP An Cultrex In Vitro Angiogen Screen Quest™ Membrane

Related Pathways

paperclip

#16808845   // Save this To Up

A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts.

Transient assays using protoplasts are ideal for processing large quantities of genetic data coming out of hi-throughput assays. Previously, protoplasts have routinely been prepared from dicot tissue or cell suspension cultures and yet a good system for rice protoplast isolation and manipulation is lacking.

2281 related Products with: A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts.

Anti AGO2 Human, Monoclon Anti AGO2 Mouse, Monoclon Anti AGO2 Human, Monoclon Anti AGO2 Mouse, Monoclon DNA (cytosine 5) methyltr Breast invasive ductal ca Digestive system tissue a Endocrine system benign, Digestive system carcinom Female reproductive syste Multiple lung carcinoma ( Male genitourinary system

Related Pathways

paperclip

#12711007   // Save this To Up

Identification of a Vitamin D response element in the human insulin receptor gene promoter.

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.

1463 related Products with: Identification of a Vitamin D response element in the human insulin receptor gene promoter.

Human integrin aVb3, affi DNA (cytosine 5) methyltr Interferon-a Receptor Typ Goat Anti-Human DRAK2, (i Goat Anti-Human DLX5, (in Goat Anti-Human DHX9 RHA, Goat Anti-Human Dachshund Mouse Anti-Human Interleu Mouse Anti-Human Insulin Mouse Anti-Human Insulin Mouse Anti-Human Insulin interleukin 17 receptor C

Related Pathways

  •  
  • No related Items
paperclip

#11131984   // Save this To Up

Adenoviral vector-mediated gene transfer: timing of wild-type p53 gene expression in vivo and effect of tumor transduction on survival in a rat glioma brachytherapy model.

This study sought to investigate modification of the radiation response in a rat 9L brain tumor model in vivo by the wild-type p53 gene (wtp53). Determination of the timing and dose of radiation therapy required the assessment of the duration of the effect of wtp53 expression on 9L tumors after in vivo transfection.

2859 related Products with: Adenoviral vector-mediated gene transfer: timing of wild-type p53 gene expression in vivo and effect of tumor transduction on survival in a rat glioma brachytherapy model.

DNA (cytosine 5) methyltr Rat TGF-beta-inducible ea Rat TGF-beta-inducible ea Gene Expression: Rat P45 Goat Anti-Rat Collagen, t pCdgCAT Mammalian CAT Exp pCAMBIA0105.1R Vector, (G pCAMBIA2300 Vector (No Re Rat monoclonal anti mouse Rat monoclonal anti mouse Human Epstein-Barr Virus Interferon-a Receptor Typ

Related Pathways